Category Archives: Miscellaneous

Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

The last run at this failed, but I think that was due to old ampicillin stocks; leading to no selective pressure for transformants that actually contained plasmid.

I’ve since remedied that.

Grew up 5mL of culture from the only two transformants in 1xLB + 100ug/mL of (fresh!) ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 3mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 10uL of sample.

Results:

Quantification (Google Sheet): 20170817_quantification_oshv_orf117_plasmid

Colony 1 – 130ng/uL
Colony 2 – 148ng/uL

Yields look perfect. Will submit for sequencing at Genewiz (they need 10uL of ~50ng/uL DNA) and see what we have here…

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Share

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

Yesterday’s transformation with freshly prepared ampicillin didn’t produce any transformants, suggesting the DNA concentration is too low.

Previously, I tried to elute the DNA from one of the spots Tim sent with 50uL. This volume was enough to soak the Whatman paper and produce excess liquid. In retrospect, I think the volume was too large and diluted the DNA too much (concentration wasn’t measurable via Qubit)

Today, I eluted with 25uL. Since this volume was too little to produce excess liquid, I created a spin “filter” to extract the absorbed liquid. Briefly, I punctured the top and bottom of a 0.5mL snap cap tube with an 18 gauge needle, inserted the Whatman paper disc into this tube, and then put this tube in a 2mL snap cap tube. This assembly was spun @ 18,000g RT for 3 mins.

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

Wow, only two colonies! Well, as they say, you only need one. Will PCR, re-streak, and inoculate 5mL liquid cultures to see if either of these colonies seem to have the insert.

Share

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

This is a repeat since the previous attempt at obtaining sufficient quantities of plasmid for sequencing failed. Although I’m not sure why, I figure it’s easy enough to re-do using ampicillin stocks that aren’t many years old. :)

The old ampicillin may not have been strong enough to put enough selective pressure on transformants, which possibly led to such little plasmid recovery.

I prepared fresh ampicillin solution (20mg/mL) and made new LB plates (ampicillin concentration 100ug/mL).

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

No transformants. So, this suggests that the original ampicillin was bad. Now, the lack of transformants suggests the plasmid concentration is too low. Will try eluting the DNA from the second spot of Whatman paper.

Share

Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

Grew up 5mL of culture from re-streaked colony #1 in 1xLB + 100ug/mL of ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 5mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 1uL of sample.

Results:

The results are not good. Using 1uL of the sample, I received an error message that the concentration was out of range – too low!

Repeated, but used 10uL of sample. Concentration was displayed as 1.13ng/uL!!

This is insufficient yield/concentration for sequencing.

It’s possible that the kit is too old (no receipt date marked on the box…)? The reagents shouldn’t go bad, but can the columns? I feel like the resins in the columns are pretty stable, just like the various buffers.

The ridiculously low yields could also possibly indicate that the bacteria don’t actually have the plasmid, but PCRs from yesterday suggest otherwise.

Maybe the column was overloaded? I’ll repeat this next week, but using smaller culture size and/or not using the column and perform an isopropanol precipitation instead…

And/or make fresh stock of ampicillin (current stock is many years old, but has been frozen).

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

RNA Isolation – Olympia oyster gonad tissue in paraffin histology blocks

My previous go at this was a little premature – I didn’t wait for Laura to fully annotate her slides/blocks. Little did I know, the tissue was mostly visceral mass and, as such, I didn’t hit much in the way of actual gonad tissue. So, I’m redoing this, now that Grace has gone through and annotated the blocks to point out gonad tissue. SN-10-16 was sent to Katherine Silliman on 20170720.

Isolated RNA from Olympia oyster gonad previously preserved with the PAXgene Tissue Fixative and Stabilizer and then embedded in paraffin blocks. See Laura’s notebook for full details on samples and preservation.

 

RNA was isolated from the following samples using the PAXgene Tissue RNA Kit (Qiagen). Gouged samples from the blocks weighing ~10mg from each of the tissues and processed according the protocol for isolating RNA from blocks of paraffin-embedded tissues.

Background on all of this is in this GitHub Issue

NF-10-22
NF-10-23
NF-10-24
NF-10-26
NF-10-28
NF-10-30
SN-10-16
SN-10-17
SN-10-20
SN-10-25
SN-10-26
SN-10-31

IMPORTANT:

  • Prior to beginning, I prepared an aliquot of Buffer TR1 by adding 40μL of β-mercaptoethanol (β-ME) to 4000μL of Buffer TR1)

Isolated RNA according to the PAXgene Tissue RNA Kit protocol with the following alterations:

  • “Max speed” spins were performed at 20,000g.
  • Tissue disruption was performed by adding ~25-50 glass beads (425 – 600μm diameter) with the Disruptor Genie @ 45C for 15mins (in the Friedman Lab).
  • Samples were eluted with 27μL of Buffer TR4 x 2, incubated @ 65C for 5mins, immediately placed on ice.

 

Results:

Samples were not quantified due to lack of proper RNA Qubit assay AND the computer that our NanoDrop1000 is hooked up to is dead. Will have Katherine Silliman perform quantification.

Samples were stored at -80C temporarily.

Samples will be sent to Katherine Silliman for high-throughput library construction and sequencing once I hear back from her regarding her availability to receive the samples.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Share

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol.

Cells were plated on pre-warmed (37C) LB Amp100 plates with X-gal.

Plates were incubated overnight at 37C.

Results:

Looks good – ample colonies and no blue colonies (blue colonies = empty vector). Will screen a subset of the colonies via cPCR.

 

 

Share

RNA Isolation – Olympia oyster gonad tissue in paraffin histology blocks

UPDATE 20170712: The RNA I isolated below is from incorrect regions of tissue. I misunderstood exactly what this tissue was, and admittedly, jumped the gun. The tissue is actually collected from the visceral mass – which contains gonad (a small amount) and digestive gland (a large amount). The RNA isolated below will be stored in one of the Shellfish RNA boxes and I will isolate RNA from the correct regions indicated by Grace

Isolated RNA from Olympia oyster gonad previously preserved with the PAXgene Tissue Fixative and Stabilizer and then embedded in paraffin blocks. See Laura’s notebook for full details on samples and preservation.

 

RNA was isolated from the following samples using the PAXgene Tissue RNA Kit (Qiagen). Gouged samples from the blocks weighing ~10mg from each of the tissues and processed according the protocol for isolating RNA from blocks of paraffin-embedded tissues.

Tissue identification is available in this GitHub Issue

NF-10-22
NF-10-23
NF-10-24
NF-10-26
NF-10-28
NF-10-30
SN-10-16
SN-10-17
SN-10-20
SN-10-25
SN-10-26
SN-10-31

IMPORTANT:

  • Prior to beginning, I prepared an aliquot of Buffer TR1 by adding 40μL of β-mercaptoethanol (β-ME) to 4000μL of Buffer TR1).
  • Reconstituted DNase I with 550μL of RNase-free H2O. Aliquoted in 100μL volumes and stored @ -20C in the “-20C Kit Components” box.

Isolated RNA according to the PAXgene Tissue RNA Kit protocol with the following alterations:

  • “Max speed” spins were performed at 20,000g.
  • Tissue disruption was performed by adding ~25-50 glass beads (425 – 600μm diameter) with the Disruptor Genie @ 45C for 15mins (in the Friedman Lab).
  • Samples were eluted with 27μL of Buffer TR4 x 2, incubated @ 65C for 5mins, immediately placed on ice and quantified on the Roberts Lab Qubit 3.0 with the RNA High Sensitivity Assay (ThermoFisher Scientific) using 5μL of each sample.

Results:

Concentrations (Google Sheet): 20170710_RNA_qubit_oly_histo_blocks

Well, the good news is that there’s RNA from all the samples and it seems to be in relatively high concentrations!

The bad news is that the concentrations for 10 of the 12 samples were too high and outside the range of the Qubit RNA HS Assay! Since we don’t have the broad range RNA assay, I can’t properly quantify the remaining samples. However, these samples are being sent to Katherine Silliman at some point, so I’ll leave it up to her to quantify the samples. I’m also guessing that she’ll run them on a Bioanalyzer to assess their integrity prior to beginning library construction, so that will also yield concentrations for the samples.

Samples were stored at -80C temporarily.

Samples will be sent to Katherine Silliman for high-throughput library construction and sequencing once I hear back from her regarding her availability to receive the samples.

Share