Category Archives: Reagent Prep

Reagent Prep

PCR – Oly RAD-seq Test-scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.

Prior to generating full-blown libraries, we need to run a “test-scale” PCR to identify the minimum number of cycles needed to produce the intended product size (166bp).

I ran PCR reactions on a subset (Sample #: 4, 7, 14, & 30) of the 10 samples that I performed adaptor ligations on earlier today.

All components were stored on ice.

dNTPs – 1mM working stock was made

  • 10μL dNTPs (10mM)
  • 90μL NanoPure H2O

 

ILL-LIB1 & 2 – 10μM working stocks were made

  • 10μL ILL-LIB1 or -LIB2 (100μM)
  • 90μL NanoPure H2O

 

ILL-HT1 & 2 – 1μM working stocks were made

  • 1μL ILL-HT1 or -HT2 (100μM)
  • 99μL NanoPure H2O

 

ILL-BC1 – 1μM working stock was made

  • 1μL ILL-BC1 (100μM)
  • 99μL NanoPure H2O

 

PCR reactions were set up on ice in 0.5mL PCR tubes.

REAGENT SINGLE REACTION (μL) x4.4
Template 8 NA
NanoPure H2O 1 4.4
dNTPs (1mM) 4 17.6
ILL-LIB1 (10μM) 0.4 1.76
ILL-LIB2 (10μM) 0.4 1.76
ILL-HT1 (1μM) 1 4.4
ILL-BC1 (1μM) 1 4.4
5x Q5 Reaction Buffer 4 17.6
Q5 DNA Polymerase 0.2 0.88
TOTAL 20 52.8

 

Combined 12μL of master mix with 8μL of the ligation reaction from earlier today.

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
27 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

We’re following the “1/4 reduced representation” aspect of the protocol. As such, 5μL of each reaction was pulled immediately after the extension (72C – machine was paused) of cycles 12, 17, 22, & 27 in order to determine the ideal number of cycles to use. Also ran the ligation reactions (labelled “Digests” on the gel below) of two samples (samples #: 4 & 7) as a pre-PCR comparison.

These samples were run on a 1x modified TAE 2% agarose gel (w/EtBr).

 

Results:

 

 

 

 

 

 

 

 

The results aren’t great. No band(s) visible in any samples at even the highest cycle number (27 cycles). Although, if you squint pretty hard, an extremely faint band might be visible in between the 100/200bp markers in the 27 cycles group.

Regardless, the PCRs will need to be repeated with an increased number of cycles. This is not terribly surprising, as the Meyer Lab protocol indicates that degraded samples will likely need a greater number of cycles than what they recommend and that cycle number will have to be determined empirically.

 

Share

Adaptor Ligation – Oly AlfI-Digested gDNA for RAD-seq

Yesterday’s AlfI over night restriction digest was heat inactivated by heating @ 65C for 10mins. Samples were stored on ice.

Continued to follow  the 2bRAD protocol (PDF) developed by Eli Meyer’s lab.

Digested DNA was not run out on a gel due to the fact that the input gDNA was degraded and a shift in the high molecular weight band (indicating the digestion was successful) would not exist because a high molecular weight band is absent in these samples.

The following oligos were reconstituted in TE buffer (pH = 8.0) to 100μM:

  • 3ILL-NR
  • 5ILL-NR
  • anti-ILL
  • ILL-BC1 (Barcode sequence: CGTGAT)
  • ILL-HT1 (Barcode sequence: ATGCAT)
  • ILL-HT2 (Barcode sequence: CGTACG)
  • ILL-LIB1
  • ILL-LIB2

Anneal Adaptors

After preparing the two adaptors below, they were incubated for 10mins @ RT:

  • Adaptor 1 (2μM final concentration of each oligo): 1.5μL of 5ILL-NR (100μM) + 1.5μL of anti-ILL (100μM) + 72μL H2O = 75μL total
  • Adaptor 2 (2μM final concentration of each oligo): 1.5μL of 3ILL-NR (100μM) + 1.5μL of anti-ILL (100μM) + 72μL H2O = 75μL total

After annealing, the adaptors were stored on ice.

 

Adaptor Ligation

All components were stored on ice. Ligation reactions were prepared on ice and performed in 0.5mL snap cap tubes.

REAGENT SINGLE REACTION (μL) x11
Digested DNA 10 NA
ATP (10mM) 1 11
10x T4 Ligase Buffer 4 44
Adaptor 1 (2μM) 5 55
Adaptor 2 (2μM) 5 55
T4 DNA Ligase 1 11
NanoPure H2O 24 264
TOTAL 50 440

Added 40μL of the master mix to each tube of AlfI-digested DNA (12μL). NOTE: I made a mistake here. I should have only combined 10μL of DNA with the 40μL of master mix for each. My mistake was due, in part, to the way the Meyer Lab 2bRAD protocol is written. In the Digestion section of the protocol, Step 5 (run 2μL of the digests on a gel) is listed as optional. However, in Step 2a of the Ligation section, it says to add the “remaining 10μL of digested DNA”. The use of the word “remaining” in this instance is misleading because it implies to use all that’s left in the tube.

Incubated ligation reaction @ 16C for 3hrs in PTC-200 thermal cycler (MJ Research) – no heated lid.

Transferred tubes to ice while preparing subsequent

Share

Restriction Digest – Oly gDNA for RAD-seq w/AlfI

Used a subset (10 samples) from the Ostrea lurida gDNA isolated 20150916 to prepare RAD libraries. This will be done to assess whether or not these samples, which appear to be heavily degraded, are viable for RAD-seq.

Followed the 2bRAD protocol (PDF) developed by Eli Meyer’s lab.

Prepared 1.2μg of each of the following samples in a volume of 10μL:

Google Sheet: 20150930_RADseq_DNA_calcs

 

Prepared a 150μM working stock of the SAM buffer needed for the restriction digestion by diluting 30μL of the supplied stock (500μM) in 70μL NanoPure H2O (total volume = 100μL). This working stock was stored @ -20C in FTR 209 in the “RAD-seq Reagents” box.

Prepared master mix for restriction enzyme reaction:

REAGENT SINGLE REACTION (μL) x11
DNA 8 NA
10x Buffer R 1.2μL 13.2μL
150μM SAM 0.8μL 8.8μL
AlfI 0.5μL 5.5μL
H2O 1.5μL 16.5μL

 

Combined 4μL of the master mix with 8μL of each sample in 0.5mL snap cap tubes. Incubated @ 37C O/N in thermal cycler (no heated lid).

Share

RAD-Seq Library Prep Reagents

A box with the above title was established in the -20C in FTR 209 containing the following:

  • Thermo Scientific AlfI: ER1801
  • NEB T4 DNA ligase, 50 μL: M0202S
  • NEB 10 mM ATP, 1 mL: P0756S
  • Promega dNTPs (10 mM each): U1511
  • NEB Q5 Taq Polymerase, 100 units: M0491S

Oligos (100μL each in TE pH=8.0; barcode sequences are in bold)

Adaptor 1
5ILL-NR: CTACACGACGCTCTTCCGATCTNR

Anti-ILL: AGATCGGAAGAGC(InvdT)

Adaptor 2
3ILL-NR: CAGACGTGTGCTCTTCCGATCTNR

ILL-Lib1: AATGATACGGCGACCACCGA

ILL-Lib2: CAAGCAGAAGACGGCATACGA

ILL-HT1: AATGATACGGCGACCACCGAGATCTACACATGCATACACTCTTTCCCTACACGACGCTCTTCCGATCT

ILL-HT2:AATGATACGGCGACCACCGAGATCTACACCGTACGACACTCTTTCCCTACACGACGCTCTTCCGATCT

ILL-BC1: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

Share