Tag Archives: Apex Red

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

PCR – RLOv Clones

Colony PCRs were performed on each of the transformations from 20151015 (RLOv_ DNA_helicase, RLOv_head_to_tail, RLOv_membrane_gene_1, RLOv_membrane_gene_2, RLOv_tail_to_fiber) to confirm successful ligations in plasmid pCR2.1 using the M13F/R vector primers.

Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp100+x-gal plate and then used to inoculate the respective PCR reactions.

Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Master mix calcs are here (Google Sheet): 20151019 – Colony PCRs RLOv

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

 

All the PCRs look good. All white colonies selected contain a PCR product of appropriate size (i.e. larger than the blue colonies; negative [-C] control). Will select clones #1 from each to grow up for plasmid prep.

Share

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

Share

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

Share

PCR – Ireland Clam RLO DNA S/6/14 #19 (from 20150130)

After previously confirming that the issue with previous PCRs was due to bad reagents, I re-ran the PCR on the clam RLO DNA isolated 20150130 using a set of universal 16s primers, as well as a universal 18s primer set to serve as a positive control that amplifiable DNA was present in the sample.

Master mix calcs are here: 20150219 – cPCR Universal Primers Apex Red MM

Primers being used are:

  • 16s/23s-F/R
  • 27F, 1492R
  • EHR16D, EHR16R (universal ehrlichia)
  • EUB-A/B
  • 18s EUK 581 F, 18s EUK 1134 R

Cycling params were:
1 cycle of:

  • 95C – 10mins

40 cycles of:

  • 95C – 15s
  • 50C – 15s
  • 72C – 1mins

Samples were run on 1.0% agarose, low TAE gel stained w/EtBr.

Results:

Ladder used was O’GenRuler 100bp DNA Ladder (Thermo-Fisher).

No sample was loaded directly next to ladder to facilitate excision, if necessary.

Each sample was accompanied by a no template control (NTC).

The ehrlichia universal primers (EHR) and the universal 18s (18s) primers are the only two primer sets that do not have contamination present in the NTCs.

Excised the EHR band and purified with Ultrafree-DA columns (Millipore). Purified DNA was stored @ -20C and will be used for cloning/sequencing next week.

Have already ordered additional primer sets of those above that are contaminated. Will re-run the PCR with those new, sterile primer sets when they arrive to obtain a larger product (the EHR amplicon is only ~350bp).

Share

PCR – Withering Syndrome Phage

We received MiSeq data back from Stan Langevin (samples submitted 20140717) and he believes he has sequenced the entire WS phage. Carolyn and Colleen designed some primers on two of the open reading frames annotated by Stan. Ran PCR with the three primer sets to test out:

  • 1_ORF25F_225_CSF, 1_ORF25R_399_CSF
  • 2_ORF25_121_CAB, 2_ORF25R_320_CAB
  • 3_ORF20F_121_CSF, 3_ORF20R_326_CSF

Master mix calcs are here: 201400813 – PCR WS phage

Cycling params:

Ran samples on 1.2% 1x TBE + EtBr.

Results:

Ladder: O’GeneRuler 100bp DNA Ladder (ThermoFisher)

Good amplification from all three primer sets. The pinto abalone sample (UW08:22-65) that should be naive for withering syndrome and phage did not amplify as expected.

Excised bands from each primer set in the 06:6-41 group and purified using Ultrafree DA spin columns (Millipore). Will save for potential cloning usage, depending on future results.

Share