Tag Archives: bioinformatics

Bioinformatics – Trimmomatic/FASTQC on C.gigas Larvae OA NGS Data

Previously trimmed the first 39 bases of sequence from reads from the BS-Seq data in an attempt to improve our ability to map the reads back to the C.gigas genome. However, Mac (and Steven) noticed that the last ~10 bases of all the reads showed a steady increase in the %G, suggesting some sort of bias (maybe adaptor??):

Although I didn’t mention this previously, the figure above also shows an odd “waves” pattern that repeats in all bases except for G. Not sure what to think of that…

Quick summary of actions taken (specifics are available in Jupyter notebook below):

  • Trim first 39 bases from all reads in all raw sequencing files.
  • Trim last 10 bases from all reads in raw sequencing files
  • Concatenate the two sets of reads (400ppm and 1000ppm treatments) into single FASTQ files for Steven to work with.

Raw sequencing files:

Notebook Viewer: 20150521_Cgigas_larvae_OA_Trimmomatic_FASTQC

Jupyter (IPython) notebook: 20150521_Cgigas_larvae_OA_Trimmomatic_FASTQC.ipynb

 

 

Output files

Trimmed, concatenated FASTQ files
20150521_trimmed_2212_lane2_400ppm_GCCAAT.fastq.gz
20150521_trimmed_2212_lane2_1000ppm_CTTGTA.fastq.gz

 

FASTQC files
20150521_trimmed_2212_lane2_400ppm_GCCAAT_fastqc.html
20150521_trimmed_2212_lane2_400ppm_GCCAAT_fastqc.zip

20150521_trimmed_2212_lane2_1000ppm_CTTGTA_fastqc.html
20150521_trimmed_2212_lane2_1000ppm_CTTGTA_fastqc.zip

 

Example of FASTQC analysis pre-trim:

 

 

Example FASTQC post-trim (from 400ppm data):

 

Trimming has removed the intended bad stuff (inconsistent sequence in the first 39 bases and rise in %G in the last 10 bases). Sequences are ready for further analysis for Steven.

However, we still see the “waves” pattern with the T, A and C. Additionally, we still don’t know what caused the weird inconsistencies, nor what sequence is contained therein that might be leading to that. Will contact the sequencing facility to see if they have any insight.

Share

Bioinformatics – Trimmomatic/FASTQC on C.gigas Larvae OA NGS Data

In another troubleshooting attempt for this problematic BS-seq Illumina data, I’m going to use Trimmomatic to remove the first 39 bases of each read. This is due to the fact that even after the previous quality trimming with Trimmomatic, the first 39 bases still showed inconsistent quality:

 

Ran Trimmomatic on just a single data set to try things out: 2212_lane2_CTTGTA_L002_R1_001.fastq.gz

Notebook Viewer: 20150506_Cgigas_larvae_OA_trimmomatic_FASTQC

Jupyter (IPython) notebook: 20150506_Cgigas_larvae_OA_trimmomatic_FASTQC.ipynb

Results:

Trimmed FASTQ: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz

FASTQC Report: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc.html

You can see how flat the newly trimmed data is (which is what one would expect).

Steven will take this trimmed dataset and try additional mapping with it to see if removal of the first 39 bases will improve the mapping.

 

Share

BLAST – C.gigas Larvae OA Illumina Data Against GenBank nt DB

In an attempt to figure out what’s going on with the Illumina data we recently received for these samples, I BLASTed the 400ppm data set that had previously been de-novo assembled by Steven: EmmaBS400.fa.

Jupyter (IPython) Notebook : 20150501_Cgigas_larvae_OA_BLASTn_nt.ipynb

Notebook Viewer : 20150501_Cgigas_larvae_OA_BLASTn_nt

Results:

BLASTn Output File: 20150501_nt_blastn.tab

BLAST e-vals <= 0.001: 20150501_Cgigas_larvae_OA_blastn_evals_0.001.txt

Unique BLAST Species: 20150501_Cgigas_larvae_OA_unique_blastn_evals.txt

 

Firstly, since this library was bisulfite converted, we know that matching won’t be as robust as we’d normally see.

However, the BLAST matches for this are terrible.

Only 0.65% of the BLAST matches (e-value <0.001) are to Crassostrea gigas. Yep, you read that correctly: 0.65%.

It’s nearly 40-fold less than the top species: Dictyostelium discoideum (a slime mold)

It’s 30-fold less than the next species: Danio rerio (zebra fish)

Then it’s followed up by human and mouse.

I think I will need to contact the Univ. of Oregon sequencing facility to see what their thoughts on this data is, because it’s not even remotely close to what we should be seeing, even with the bisulfite conversion…

Share

Quality Trimming – C.gigas Larvae OA BS-Seq Data

Jupyter (IPython) Notebook: 20150414_C_gigas_Larvae_OA_Trimmomatic_FASTQC.ipynb

NBviewer: 20150414_C_gigas_Larvae_OA_Trimmomatic_FASTQC.ipynb

 

Trimmed FASTQC

400ppm Index – GCCAAT

20150414_trimmed_2212_lane2_GCCAAT_L002_R1_001_fastqc.html
20150414_trimmed_2212_lane2_GCCAAT_L002_R1_002_fastqc.html
20150414_trimmed_2212_lane2_GCCAAT_L002_R1_003_fastqc.html
20150414_trimmed_2212_lane2_GCCAAT_L002_R1_004_fastqc.html
20150414_trimmed_2212_lane2_GCCAAT_L002_R1_005_fastqc.html
20150414_trimmed_2212_lane2_GCCAAT_L002_R1_006_fastqc.html

1000ppm Index – CTTGTA

20150414_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc.html
20150414_trimmed_2212_lane2_CTTGTA_L002_R1_002_fastqc.html
20150414_trimmed_2212_lane2_CTTGTA_L002_R1_003_fastqc.html
20150414_trimmed_2212_lane2_CTTGTA_L002_R1_004_fastqc.html

 

 

Share

Epinext Adaptor 1 Counts – LSU C.virginica Oil Spill Samples

Before contacting the Univ. of Oregon facility for help with this sequence demultiplexing dilemma, I contacted Epigentek to find out what the other adaptor sequence that is used in the EpiNext Post-Bisulfite DNA Library Preparation Kit (Illumina). I used grep and fastx_barcode_splitter to determine how many reads (if any) contained this adaptor sequence. All analysis was performed in the embedded Jupyter (IPython) notebook embedded below.

NBviewer: 20150317_LSU_OilSpill_EpinextAdaptor1_ID.ipynb

 

Results:

This adaptor sequence is not present in any of the reads in the FASTQ file analyzed.

Share

TruSeq Adaptor Counts – LSU C.virginica Oil Spill Sequences

Initial analysis, comparing barcode identification methods, revealed the following info about demultiplexing on untrimmed sequences:

Using grep:

long barcodes: Found in ~12% of all reads

short barcodes: Found in ~25% of all reads

Using fastx_barcode_splitter:

long barcodes, beginning of line: Found in ~15% of all reads

long barcodes, end of line: Found in < 0.008% of all reads (yes, that is actually percentage)

short barcodes, beginning of line: Found in ~1.3% of all reads

short barcodes, end of line: Found in ~2.7% of all reads

 

Decided to determine what percentage of the sequences in this FASTQ file have just the beginning of the adaptor sequence (up to the 6bp barcode/index):

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

This was done to see if the numbers increased without the barcode index (i.e. see if majority of sequences are being generated from “empty” adaptors lacking barcodes).

The analysis was performed in a Jupyter (IPython) notebook and the notebook is linked, and embedded, below.

NBViewer: 20150316_LSU_OilSpill_Adapter_ID.ipynb

 

Results:

Using grep:

15% of the sequences match

That’s about 3% more than when the adaptor and barcode are searched as one sequence.

Using fastx_barcode_splitter:

beginning of line – 17% match

end of line – 0.06% match

The beginning of line matches are ~2% higher than when the adaptor and barcode are searched as one sequence.

Will contact Univ. of Oregon to see if they can shed any light and/or help with the demultiplexing dilemma we have here. Lots of sequence, but how did it get generated if adaptors aren’t present on all of the reads?

Share