Tag Archives: DNA helicase

qPCR – RLOv DNA Helicase Assay Limit of Detection

Continuing RLOv DNA Helicase qPCR assay validation.

This is the second of three plates to establish the assay’s limit of detection. The first plate was run yesterday (20160121).

The limit of detection assessment is conducted in the following fashion:

  • Three plates of qPCRs; each plate run on different days.

  • On each plate; 20 reps each of the following standard curve copy numbers: 30, 10, 3, 1

Master mix calcs (Google Sheet): 201600121 – qPCR RLOv DNA Helicase Promega LoD-1

Plate layout, cycling params, etc can be seen in the qPCR Report (see Results below).

Results:
qPCR Report (PDF): Sam_2016-01-22 10-15-55_CC009827.pdf
qPCR Data File (CFX96): Sam_2016-01-22 10-15-55_CC009827.pcrd

Share

Primer-BLAST – Withering Syndrome Phage Primers for qPCR & ISH

After designing new primers for use in Withering Syndrome phage (RLOv) identification on 20150706, ran Primer-BLAST via NCBI’s website to assess primer specificity. Ran Primer-BLAST with each primer set against the NCBI nr Viruses (Tax ID:10239 ) and Prokaryotes (Tax ID: 2) nucleotide databases. Excluded uncultured/environmental samples from the databases. The general setting for the Primer-BLASTs can be seen in the screen capture below. Entered in each primer set in the “Primer Parameters” boxes.

The Primer-BLAST only exhibits an output if either of the primers produce a match. When primers do have a match in the database, an alignment of primer(s) is shown on the matching template. Dots in the alignment are exact nucleotide matches, whereas mismatched nucleotides are simply displayed with their corresponding letter in the alignment.

Results:

qPCR Primers

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG


ISH Primers

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

This shows some matching to a single template and only with the forward primer. It should be fine to use for ISH.

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

The forward primer and the reverse primer show some matching, but those matches exist in two different species. As such, these primers should be fine for use in ISH.

Share