Tag Archives: EIMD

MGA>SJC>SEA>FHL

Rainier_CJC

Washington & the San Juans command beautiful photos to be taken. 

San_Juans_CJC FHL_CJC

Starting the Ecology of Infectious Marine Disease Course here at Friday Harbor Labs – super excited!

…More updates to come.

Share

Transcriptome Assembly

 

Trinity

################################
## Counts of transcripts, etc.
################################
Total trinity 'genes':  117729
Total trinity transcripts:  145222
Percent GC: 40.87

########################################
Stats based on ALL transcript contigs:
########################################

    Contig N10: 3392
    Contig N20: 2262
    Contig N30: 1685
    Contig N40: 1268
    Contig N50: 946

    Median contig length: 335
    Average contig: 617.51
    Total assembled bases: 89676218


#####################################################
## Stats based on ONLY LONGEST ISOFORM per 'GENE':
#####################################################

    Contig N10: 3252
    Contig N20: 2047
    Contig N30: 1465
    Contig N40: 1065
    Contig N50: 767

    Median contig length: 305
    Average contig: 547.96
    Total assembled bases: 64511364


#!/bin/bash

TRIN="/home/ggoetz/compile/trinityrnaseq_r20140413p1"

export PATH=~/compile/rsem-1.2.3/sam:${PATH}

${TRIN}/Trinity 
    --seqType fq 
    --JM 44G 
    --left left.fq 
    --right right.fq 
    --CPU 6 
    --normalize_reads 
    --min_kmer_cov 2 
    --quality_trimming_params 
    "LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLENGTH:36"
In [3]:
!head //Volumes/web/cnidarian/SeaStar/trinity_assemblies/run1/Trinity.fasta
>c2_g1_i1 len=233 path=[20:0-32 20:33-65 20:66-98 52:99-232]

TCTTGGTCTTGGACGTGGACTTGCTGGTCTTGGTCTTGGTCTTGGACGTGGACTTGCTGG

TCTTGGTCTTGGTCTTGGACGTGGACTTGCTGGTCTTGGTCTTGTTCTTGGTCTTGTTCT

TTGTCTTGTTCTTGTTCTTGTTTATGTCCTTGTTTAGGGTTGTTGTTGGGTTTGTTGCTG

TGTTTTGGCGGGTTGTTGTTGTTTTGGGGGTTTTGGTTGTTTGTTTGTTTGTG

>c108_g1_i1 len=239 path=[1:0-131 133:132-238]

CACTTCGTATATGCTTTATAGACTTCTTGTACGATGTAAAACTCAGACTTTTAAAATCTT

TTCTCATTTTTTGTAAAACTTTATAGAATAATTTTTTCTCTCTTGGGATATATCTACACT

TTCAACTTGCTTAAAAAAAATATAGATAGTGTATGGTGTATGGAGGATTGTGTATTTCAC

ATGTGAGGTACTGTGTTACTAAATTTAGTTGTCGTGACAGAGAGAGGAACAGAGCAGGG


In [5]:
!fgrep -c ">" /Volumes/web/cnidarian/SeaStar/trinity_assemblies/run1/Trinity.fasta
145222


In [6]:
!fgrep -c ">" /Volumes/web/cnidarian/SeaStar/trinity_assemblies/run2/Trinity.Cufffly.fasta
160038


CLC

Trimming

greenbird_1977290F.png

de novo assembly

greenbird_19772A25.png

summary stats

greenbird_19772955.png

In [8]:
!head /Volumes/web/cnidarian/SeaStar_transc_v2.fa
>3291_5903_10007_H94MGADXX_V_CF71_ATCACG_R1_(paired)_trimmed_(paired)_contig_1

CAAATATATGAACGGTTGATTGTCAACGATTAGTACATGTTTTCATTGTTCCCCACGCCC

GCCCCCCCCCACTCAAACATTTAAAGTGTGAAATATTATTTATCCACAAATTTCCTTAAA

CCTGCAAACTTGTCTGCTGTCTCTTATTGGAAGTTATGAAAAAGAACAACGGGTTTTCTT

TAAAGGGTCTGCGTGCGATTTTCAACCTTTTGAGTAATAGCAGTTATTTTGATAACCGAT

TTTTTTCAAAGCTCAACAGCTTTTTAAAATAAGGAATCCTATAATGGCCAAACGAATACT

ATAAAAATAAGGGTTCTCTTAATTGTATAAAACGTATAATTTTATCAATTTTGGGACCGT

GTAATTTTTTAAAGACCACAAGAATGTTACATACAACAAATAGACGAAACTCGTAGCTTT

GGAAACTACGTCATGGGCGTTTGGTCAAAAGCTGGAGAGAAAGAGAGGTGGGGTGCCAGA

CTTAAGTAGTCACGTGATCTGACCAACGCACATCGGAAGCTCGATCGGATGAAATCTTCT


In [9]:
!fgrep -c ">" /Volumes/web/cnidarian/SeaStar_transc_v2.fa
30578


In []:

 

Share

Examing HTS data upon arrival

Data is on public server http://owl.fish.washington.edu/nightingales/P_helianthoides/

In [2]:
from IPython.display import HTML
HTML('<iframe src=http://owl.fish.washington.edu/nightingales/P_helianthoides/ width=700 height=450></iframe>')
Out[2]:

FastQC IPlant Option

See FastQC documentation for interpretation of results.
Upload fastq.gz files to IPlant (likely already done)

_31__Discovery_Environment_195F79DC.png

FastQC Local Option

FastQC can also be downloaded and run locally

Output

In [41]:
In [43]:
from IPython.display import HTML
HTML('<iframe src= 
http://eagle.fish.washington.edu/cnidarian/3291_5903_10007_H94MGADXX_V_CF71_ATCACG_R1_fastqc/fastqc_report.html 
width=700 height=450></iframe>')
Out[43]:
In []:

 

Share