Tag Archives: gel

PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Share

DNA Isolation – Geoduck gDNA for Illumina-initiated Sequencing Project

We were previously approached by Cindy Lawley (Illumina Market Development) for possible participation in an Illumina product development project, in which they wanted to have some geoduck tissue and DNA on-hand in case Illumina green-lighted the use of geoduck for testing out the new sequencing platform on non-model organisms. Well, guess what, Illumina has give the green light for sequencing our geoduck! However, they need at least 4μg of gDNA, so I’m isolating more.

Isolated DNA from ctenidia tissue from the same Panopea generosa individual used for the BGI sequencing efforts. Tissue was collected by Brent & Steven on 20150811.

Used the E.Z.N.A. Mollusc Kit (Omega) to isolate DNA from five separate ~60mg pieces of ctenidia tissue according to the manufacturer’s protocol, with the following changes:

  • Samples were homogenized with plastic, disposable pestle in 350μL of ML1 Buffer
  • Incubated homogenate at 60C for 1hr
  • No optional steps were used
  • Performed three rounds of 24:1 chloroform:IAA treatment
  • Eluted each in 50μL of Elution Buffer and pooled into a single sample

Quantified the DNA using the Qubit dsDNA BR Kit (Invitrogen). Used 1μL of DNA sample.

Concentration = 162ng/μL (Quant data is here [Google Sheet]: 20170105_gDNA_geoduck_qubit_quant

Yield is great (total = ~32μg).

Evaluated gDNA quality (i.e. integrity) by running 162ng (1μL) of sample on 0.8% agarose, low-TAE gel stained with ethidium bromide.

Used 5μL of O’GeneRuler DNA Ladder Mix (ThermoFisher).

 

Results:

 

 

DNA looks good: bright high molecular weight band, minimal smearing, and minimal RNA carryover (seen as more intense “smear” at ~500bp).

Will send off 10μg (they only requested 4μg) so that they have extra to work with in case they come across any issues.

Share

DNA Isolation – Geoduck gDNA for Potential Illumina-initiated Sequencing Project

We were approached by Cindy Lawley (Illumina Market Development) yesterday to see if we’d be able to participate in some product development. We agreed and need some geoduck DNA to send them, in case she’s able to get our species greenlighted for use.

Isolated DNA from ctenidia tissue from the same Panopea generosa individual used for the BGI sequencing efforts. Tissue was collected by Brent & Steven on 20150811.

Used the E.Z.N.A. Mollusc Kit (Omega) to isolate DNA from two separate 50mg pieces of ctenidia tissue according to the manufacturer’s protocol, with the following changes:

  • Samples were homogenized with plastic, disposable pestle in 350μL of ML1 Buffer
  • Incubated homogenate at 60C for 1hr
  • No optional steps were used
  • Performed three rounds of 24:1 chloroform:IAA treatment
  • Eluted each in 50μL of Elution Buffer and pooled into a single sample

Quantified the DNA using the Qubit dsDNA BR Kit (Invitrogen). Used 1μL of DNA sample.

Concentration = 19.4ng/μL (Quant data is here [Google Sheet]: 20161221_gDNA_qubit_quant

Yield is low (~1.8μg), but have enough to satisfy the minimum of 1μg requested by Cindy Lawley.

Evaluated gDNA quality (i.e. integrity) by running ~250ng (12.5μL) of sample on 0.8% agarose, low-TAE gel stained with ethidium bromide.

Used 5μL of O’GeneRuler DNA Ladder Mix (ThermoFisher).

 

Results:

 

 

 

 

Overall, the sample looks good. Strong, high molecular weight band is present with minimal smearing. However, there is a smear in the ~500bp range. This is most likely residual RNA. This is surprsing since the E.Z.N.A Mollusc Kit includes n RNase step. Regardless, having intact, high molecular weight DNA is the important part for this project. Will prepare to send remainder (~1.5μg) of geoduck to Illumina with other requested samples.

Share

DNA Isolation – Ostrea lurida DNA for PacBio Sequencing

In an attempt to improve upon the partial genome assembly we received from BGI, we will be sending DNA to the UW PacBio core facility for additional sequencing.

Isolated DNA from mantle tissue from the same Ostrea lurida individual used for the BGI sequencing efforts. Tissue was collected by Brent & Steven on 20150812.

Used the E.Z.N.A. Mollusc Kit (Omega) to isolate DNA from two separate 50mg pieces of mantle tissue according to the manufacturer’s protocol, with the following changes:

  • Samples were homogenized with plastic, disposable pestle in 350μL of ML1 Buffer
  • Incubated homogenate at 60C for 1.5hrs
  • No optional steps were used
  • Performed three rounds of 24:1 chloroform:IAA treatment
  • Eluted each in 50μL of Elution Buffer and pooled into a single sample

Quantified the DNA using the Qubit dsDNA BR Kit (Invitrogen). Used 1μL of DNA sample.

Concentration = 326ng/μL (Quant data is here [Google Sheet]: 20161214_gDNA_Olurida_qubit_quant

Yield is good and we have more than enough (~5μg is required for sequencing) to proceed with sequencing.

Evaluated gDNA quality (i.e. integrity) by running ~500ng (1.5μL) of sample on 0.8% agarose, low-TAE gel stained with ethidium bromide.

Used 5μL of O’GeneRuler DNA Ladder Mix (ThermoFisher).

Results:

 

 

Overall, the gel looks OK. A fair amount of smearing, but a strong, high molecular weight band is present. The intensity of the smearing is likely due to the fact that the gel is overloaded for this particular well size. If I had used a broader comb and/or loaded less DNA, the band would be more defined and the smearing would be less prominent.

Will submit sample to the UW PacBio facility tomorrow!

Share

Agarose Gel – Oly gDNA for BS-seq Libraries, Take Two

The gel I ran earlier today looked real rough, due to the fact that I didn’t bother to equalize loading quantities of samples (I just loaded 1μL of all samples regardless of concentration). So, I’m repeating it using 100ng of DNA from all samples.

Additionally, this gel also includes C.gigas samples that Katie Lotterhos sent to us to see how they look.

Ran a 0.8% agarose, low-TAE gel, stained with ethidium bromide.

Results:

 

Look at that! The samples look MUCH nicer when they’re not overloaded and uniformly loaded!

Most have a prominent high molecular weight band (the band that’s closes to the top of the ladder, not the DNA visible in the wells). All exhibit smearing, but 2NF1 shows a weird accumulation of low molecular weight DNA.

Katie’s C.gigas samples (M1, M2, M3) look similar to the Olympia oyster gDNA, however her samples appear to have residual RNA in them (the fuzzy band ~500bp).

Will discuss with Steven which samples he wants to use for bisulfite treament and library construction.

Share

Agarose Gel – Oly gDNA for BS-seq Libraries

Ran 1μL of each sample from yesterday’s DNA isolation on a 0.8% agarose, low-TAE gel, stained with ethidium bromide.

 

Results:

 

 

Since I didn’t load equal quantities of DNA, the intensities across the various samples is highly variable.

Those samples with high degree of smearing are also those with the highest concentrations. Thus, one would expect to be able to visualize a greater range of DNA sizes in a gel (because more DNA is present). Notice the samples with nice, high molecular weight bands and little smearing (1NF16, 1NF17). These are less than half the concentrations of all the samples that exhibit extensive smearing (2NF3, 2NF8, 1NF12). So, I think all samples will be fine for proceeding with bisulfite conversion and subsequent library construction.

However, I should re-run this gel using equalized DNA quantities for all samples…

 

Share

DNA Quality Assessment – Geoduck & Olympia Oyster gDNA

Have three separate sets of geoduck & olympia oyster gDNA that need to be run on gels before sending to BGI for genome sequencing:

GEODUCK

 

OLYMPIA OYSTER

 

Ran 100ng of each sample on a 0.8% agarose 1x modified TAE gel w/EtBr.

Results:

 

All the samples from both sets appear to be overloaded. Overloading is generally seen as the streaking seen immediately above each band.

GEODUCK

Overall, the samples look pretty good. Sadly, the worst of the three (due to the most smearing – i.e. degradation) appears to be the DNA extracted using the E.Z.N.A. Mollusc Kit (Omega BioTek).

Also of note are the two bands present in the DNAzol sample. These bands are likely ribosomal RNA because I neglected to perform a RNase treatment during the extraction. Doh!

 

OLYMPIA OYSTER

None of them are particularly great. Just like the geoduck set, the worst of the three came from the E.Z.N.A Mollusc Kit (Omega BioTek).

Also, just like the geoduck set, there are two bands present in the DNAzol sample. These bands are likely ribosomal RNA because I neglected to perform a RNase treatment during the extraction. Doh!

The phenol-chloroform clean up sample is either jacked up or severely overloaded, based on the crazy streaking that’s present. However, this sample looked similar after the initial extraction on 20151113.

 

I will send these samples separately (i.e. will not pool them into single samples) to BGI to run QC and, hopefully, add them to the DNA they already have to complete the genome sequencing for these two projects.

Share