Tag Archives: in-situ hybridization

In-situ Hybridization (ISH) – RLOv Membrane Gene 1, Tail Fiber Gene: Day 3

All washes/rinses were performed in cylindrical glass slide incubators at room temp (30mL):

  • Slides were briefly rinsed in dH2O three times.
  • Slides were counter stained with 0.05% aqueous Bismark Brown Y for 3mins.
  • Slides were briefly rinsed in dH2O, then 70% EtOH, then 100% EtOH.
  • Slides were air-dried in the fume hood.
  • Coverslips were added to each slide with three drops of Permount.
  • Permount was allowed to dry O/N at RT.

Images were captured using Nikon BR Essentials.

The same section of each slide (within an accession number set) was captured at 4x, 10x, and 20x magnifications for comparisons. Auto white balance adjustment was the only image manipulation performed. All images (see Results below) are as they were captured by the software.

Results:

Quick summary: Both probes appear to be functional! With that being the case, I will proceed to run ISH on black abalone samples (these test ISHs were with red abalone) for the proper assessment of RLOv localization.

All images are here (Dropbox): 20151204_ISH_RLOv

Tryptic images of 10x magnifications are presented below showing the H&E staining, negative control and RLOv probe.

ISH staining is expected to appear as dark brown staining.


08:1-7 (RLOv)

H&E – RLO inclusions are seen as the deep purple oblong structures.

Negative Control – RLO inclusions exhibit no staining and appear as oblong empty regions. These regions also no have any apparent cell wall/membrane around them. This is in contrast to the two other accession groups (08:1-12 & 08:1-15).

RLOv tail fiber – Staining is noticeable surrounding the RLO inclusion locations, but not within the inclusions. The staining is similar to the 08:1-12 negative control. So, it’s difficult to say if the staining in this sample is binding to its intended target (RLOv tail fiber) or if the difference seen is simply due to the particular section of this tissue.

RLOv membrane gene 1 – Not shown due to this region of tissue not being present on the slide.

 


 

08:1-12 (RLO CLASSIC)

H&E – RLO inclusions are seen as the deep purple oblong structures.

Negative Control – RLO inclusions appear similar to air bubbles, with no staining within them.

RLOv probes – Both probes stain within the RLO inclusions.


 

08:1-15 (RLO STIPPLED)

H&E – RLO inclusions are seen as light purple bulbous structures.

Negative Control – RLO inclusions are actually stained brown and are very noticeable. This is not expected.

RLOv membrane gene 1 - The staining is in the same locations as the negative control RLO inclusions. Intensity-wise, the staining seen from this probe is not much different than the negative control. However, the way the staining appears within the inclusions is different than the negative control. Not sure if this indicative of the probe working or if the different appearance is due to difference in tissue sections.

RLOv tail fiber – The staining is in the same locations as the negative control RLO inclusions. However, the intensity of the staining with the RLOv tail fiber probe is a much deeper brown, suggesting that the probe is binding within the RLO inclusions.

Share

In-situ Hybridization (ISH) – RLOv Membrane Gene 1, Tail Fiber Gene: Day 2

All washes/rinses were performed in cyclindrical glass slide incubators (30mL):

STRINGENCY WASHES

  • All SSC washes were pre-heated to appropriate temps before proceeding
  • Hybridization solution was discarded and slides rinsed for ~30mins in 2x SSC.
  • Cover slips were removed.
  • Slides were washed twice in 2x SSC 15mins @ 40C.
  • Slides were washed three times in 1x SSC 15mins @ 40C.
  • Slides were washed once in 0.5x SSC 15mins @ 40C.
  • Tissue was equilibrated in Buffer 1 (100mM Tris-HCl, 10mM NaCl, pH = 7.5) 10mins @ RT.
  • Tissues were blocked with Blocking Buffer (Buffer 1 + 2% sheep serum + 0.3% Triton-X 100) for 1hr @ RT (500uL on each slide w/cover slips – sitting flat on bench top).

DETECTION

  • Antibody solution (Anti-Digoxigenin-AP Fab fragments [Roche - Exp Nov. 2010]) – Diluted anti-DIG 1:1000 in Blocking Buffer. Anti-DIG is stored @ 4C in FSH 240 on Lisa’s shelf.
  • Added 1mL of antibody solution to each slide and incubated without a cover slip for 2hrs @ RT – sitting flat on bench top.
  • Rinsed slides with Buffer 1 for 10mins, two times.
  • Rinsed slides with Buffer 2 (100mM tris-HCl, 100mM NaCl, 50mM MgCl2; pH = 9.5) for 10mins.
  • Incubated slides in substrate solution (30mL Buffer 2 + 135uL NBT [Roch - Exp Feb 2010 - 4-nitro blue tetrazolium] + 75uL BCIP [Roche Exp Nov 2010 - 5-Bromo-4-chloro-3-indolyl phosphate]) O/N @ RT in the dark. Both NBT & BCIP are stored @ -20C in FSH 236 in the “ISH Reagents” box.
Share

In-situ Hybridization (ISH) – RLOv Membrane Genes 1 & 2, Tail Fiber Gene: Day 1

To test out the viability of these RLOv ISH probes (from 20151109) and not waste black abalone slides if this doesn’t work, I selected three unstained red abalone post-esophagus sections:

RLO – NO PHAGE

  • 08:1-12-2
  • 08:1-12-3
  • 08:1-12-4

RLOv

  • 08:1-7-7
  • 08:1-7-8
  • 08:1-7-9

RLO STIPPLED – NO PHAGE

  • 08:1-15-7
  • 08:1-15-8
  • 08:1-15-9

All slides were processed in a single, horizontal glass slide incubator (200mL), unless otherwise noted.

All steps were conducted at room temperature (RT), unless otherwise noted.

DEPARAFFINIZATION & REHYDRATION

  • All slides were deparaffinized with three changes of xylene (SafeClear II; Fisher) for 10mins each.
  • Slides were hydrated with a graded ethanol series (100%, 100%, 80%, 70%, 50%) for 3mins each.
  • Slides were rinsed with molecular grade H2O.

PREHYBRIDIZATION

  • Tissue sections were equilibrated in Tris Buffer (0.2M Tris-HCl, 2.0mM CaCl, pH = 7.2) for 5mins.
  • Tissues were permeabilized for 1.5hrs in preheated 50ug/mL Proteinase K (Qiagen) in Tris Buffer @ 56C.
  • Slides were rinsed with 1x PBS three times, 10mins each.
  • Slides were incubated 30mins in 30mL Prehybridization Buffer (50% deionized formamide, 4x SSC) @ 53C in a cylindrical glass slide incubator due to limited volume of deionized formamide available:

  • Prepared probes by boiling 3mins and immediately incubating in ice water bath for 30mins.
  • Slides were rinsed with 2x SSC and air dried for 5mins.
  • Probes were diluted 1:300 in 1000uL of Prehybridization Buffer. All three negative control probes (indicated by “-C” in subsequent labeling) were combined into a single dilution.

NOTE: RLOv Membrane Gene 2 probe was ruined because boiling water got into the tube during denaturation. This didn’t happen to any of the other tubes that were all boiled at the same time. Not sure what happened. However, this may have worked out OK because I did not pull enough slides to accomodate the negative control probes. So, now that I’m not able to test three probes, I can use the negative control probes!

HYRBIDIZATION

  • 300uL of probe solutions and cover slip were added to the following slides:

  • The three groups of slides were placed into separate slide cases and a 1mL of Prehybridization Buffer was added to each case (to maintain high humidity during incubation).
  • The cases were incubated on their sides O/N @ 53C.
Share

PCR – RLOv In-situ Hybridization (ISH) Probes

Ran probe-labeling PCRs to use in in-situ hybridization (ISH) using the PCR DIG Probe Sysnthesis Kit (Roche). Generated PCR probes for using the following BamHI-linearized plasmids:

  • pCR2.1/RLOv_membrane_gene_1
  • pCR2.1/RLOv_membrane_gene_1
  • pCR2.1/RLOv_tail_fiber

The Roche protocol recommends using only 10pg of plasmid DNA for probe labelling. As such, all three probes were diluted 1:10,000. A 1:1000 (999μL H2O + 1μL of plasmid) was made first. Then a 1:10 dilution was made (90μL H2O + 10μL from 1:1000 dilution of plasmid).

Additionally, I ran half reactions to conserve kit components. Roche recommends 50μL reactions; I ran 25μL and scaled all components appropriately.

All reactions were set up on ice and run in 0.2mL strip-cap PCR tubes.

Reaction calculations are here (Google Sheet): 20151109 – RLOv ISH Probe PCRs

Cycling params:

  1. 95C – 5mins
  2. 95C – 15s
  3. 55C – 15s
  4. 72C – 30s
  5. Go to Step 2, repeat 39 times.
  6. 72C – 10mins

After the PCR, 5μL of each reaction was run on a gel.

Results:

Hyperladder I (Bioline)

PCR DIG probe labelling products run on 1.1% agarose 1x TBE gel stained w/EtBr. A ‘+’ indicates DIG reaction, while a ‘-‘ indicates no DIG in reaction.

Two reactions were run for each plasmid: one with the DIG label (indicated by a ‘+’) and one without (indicated by a ‘-‘). If the labeling was successful, the PCR products from those reactions containing DIG will be larger (i.e. migrate slower) than those without. That is exactly what we see in each of the three potential ISH targets.

So, we now have three ISH probes ready for action! Will proceed with making fresh ISH buffers and ISH.

Probes were transferred to 0.5mL snap cap tubes and stored in my -20C box.

Share

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

Share

Primer-BLAST – Withering Syndrome Phage Primers for qPCR & ISH

After designing new primers for use in Withering Syndrome phage (RLOv) identification on 20150706, ran Primer-BLAST via NCBI’s website to assess primer specificity. Ran Primer-BLAST with each primer set against the NCBI nr Viruses (Tax ID:10239 ) and Prokaryotes (Tax ID: 2) nucleotide databases. Excluded uncultured/environmental samples from the databases. The general setting for the Primer-BLASTs can be seen in the screen capture below. Entered in each primer set in the “Primer Parameters” boxes.

The Primer-BLAST only exhibits an output if either of the primers produce a match. When primers do have a match in the database, an alignment of primer(s) is shown on the matching template. Dots in the alignment are exact nucleotide matches, whereas mismatched nucleotides are simply displayed with their corresponding letter in the alignment.

Results:

qPCR Primers

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG


ISH Primers

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

This shows some matching to a single template and only with the forward primer. It should be fine to use for ISH.

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

The forward primer and the reverse primer show some matching, but those matches exist in two different species. As such, these primers should be fine for use in ISH.

Share

Primer Design – Withering Syndrome Phage for qPCR & ISH

Stan Langevin recently annotated the Withering Syndrome (WS) bacteriophage genome he previously assembled. Additionally, after discussing with Carolyn, they decided on two new potential qPCR targets and three potential in-situ hybridization (ISH) targets. Stan provided a FASTA file with the five sequences and primers were designed using Primer3Plus.

For qPCR primers, amplicon length range was set to 150-250bp. Additionally, I had Primer3Plus design an internal primer for potential future use as a fluorescent probe, should we ever establish one of these qPCRs as a validated WS phage assay.

The ISH primers amplicon length range was set to 400-500bp.

All primers (excluding probes) will be ordered from IDT.


qPCR

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA
Probe: TGCGCATGCTATCCATGGAAACA

 

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG
Probe: GCCTGTGATCTCAAACAACGCTGC


 

ISH

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

 

 

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

Share

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 3

Slides were briefly rinsed in dH2O three times.

Slides were counter stained with 0.05% aqueous Bismark Brown Y for 3mins @ RT.

Slides were briefly rinsed in dH2O, then 70% EtOH, then 100% EtOH.

Slides were air-dried in the fume hood.

Coverslips were added to each slide with three drops of Permount.

Permount was allowed to dry O/N at RT.

Share

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 2

Stringency Washes

Hybridization solution was discarded and slides rinsed for ~30mins in 2x SSC.

Cover slips were removed.

Slides were washed twice in 2x SSC 15mins @ 40C.

Slides were washed three times in 1x SSC 15mins @ 40C.

Slides were washed once in 0.5x SSC 15mins @ 40C.

Tissue was equilibrated in Buffer 1 (100mM Tris-HCl, 10mM NaCl, pH = 7.5) 10mins @ RT.

Tissues were blocked with Blocking Buffer (Buffer 1 + 2% sheep serum + 0.3% Triton-X 100) for 1hr @ RT (500uL on each slide).

Detection

Antibody solution – Diluted alkaline phosphatase-labelled sheep anti-DIG 1:1000 in Blocking Buffer.

Added 1mL of antibody solution to each slide and incubated without a cover slip for 2hrs @ RT.

Rinsed slides with Buffer 1 for 10mins, two times.

Rinsed slides with Buffer 2 (100mM tris-HCl, 100mM NaCl, 50mM MgCl2; pH = 9.5) for 10mins.

Incubated slides in substrate solution (10mL Buffer 2 + 45uL NBT [nitroblue tetrazolium] + 25uL BCIP) O/N @ RT.

Share

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 1

Selected three unstained abalone post-esophagus sections from samples positive for the phage (08:36-17B 2-4) and three unstained sections negative for phage (08:13-5A 7-9).

All slides were processed in a single, vertical glass slide incubator, unless noted.

All slides were deparaffinized with three changes of xylene (SafeClear II; Fisher) for 10mins each.

Slides were hydrated with a graded ethanol series (100%, 100%, 80%, 70%, 50%) for 3mins each.

Slides were rinsed with molecular grade H2O.

Tissue sections were equilibrated in Tris Buffer (0.2M Tris-HCl, 2.0mM CaCl, pH = 7.2) for 5mins.

Tissues were permeabilized for 1.5hrs in preheated 50ug/mL Proteinase K (Qiagen) in Tris Buffer @ 56C.

Slides were rinsed with 1x PBS three times, 10mins each.

Slides were incubated 30mins in Prehybridization Buffer (50% deionized formamide, 4x SSC) @ 53C.

Prepared probes (from 20141008) by boiling 3mins and immediately incubating in ice water bath for 30mins.

Slides were rinsed with 2x SSC and air dried for 5mins.

Probes were diluted 1:300 in 600uL of Prehybridization Buffer. Both negative control probes were combined into a single dilution.

300uL of probe solutions and cover slip were added to the following slides:

  • Phage ORF25: 08:36-17B 2, 08:13-5A 7

  • WSN1: 08:36-17B 3, 08:13-5A 8

  • Negative Controls: 08:36-17B 4, 08:13-5A 9

The three groups of slides were placed into separate slide cases and a 1mL of Prehybridization Buffer was added to each case (to maintain high humidity during incubation).

The cases were incubated on their sides O/N @ 53C.

Share