Tag Archives: O’geneRuler DNA Ladder Mix

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Share

DNA Isolation – Geoduck gDNA for Potential Illumina-initiated Sequencing Project

We were approached by Cindy Lawley (Illumina Market Development) yesterday to see if we’d be able to participate in some product development. We agreed and need some geoduck DNA to send them, in case she’s able to get our species greenlighted for use.

Isolated DNA from ctenidia tissue from the same Panopea generosa individual used for the BGI sequencing efforts. Tissue was collected by Brent & Steven on 20150811.

Used the E.Z.N.A. Mollusc Kit (Omega) to isolate DNA from two separate 50mg pieces of ctenidia tissue according to the manufacturer’s protocol, with the following changes:

  • Samples were homogenized with plastic, disposable pestle in 350μL of ML1 Buffer
  • Incubated homogenate at 60C for 1hr
  • No optional steps were used
  • Performed three rounds of 24:1 chloroform:IAA treatment
  • Eluted each in 50μL of Elution Buffer and pooled into a single sample

Quantified the DNA using the Qubit dsDNA BR Kit (Invitrogen). Used 1μL of DNA sample.

Concentration = 19.4ng/μL (Quant data is here [Google Sheet]: 20161221_gDNA_qubit_quant

Yield is low (~1.8μg), but have enough to satisfy the minimum of 1μg requested by Cindy Lawley.

Evaluated gDNA quality (i.e. integrity) by running ~250ng (12.5μL) of sample on 0.8% agarose, low-TAE gel stained with ethidium bromide.

Used 5μL of O’GeneRuler DNA Ladder Mix (ThermoFisher).

 

Results:

 

 

 

 

Overall, the sample looks good. Strong, high molecular weight band is present with minimal smearing. However, there is a smear in the ~500bp range. This is most likely residual RNA. This is surprsing since the E.Z.N.A Mollusc Kit includes n RNase step. Regardless, having intact, high molecular weight DNA is the important part for this project. Will prepare to send remainder (~1.5μg) of geoduck to Illumina with other requested samples.

Share

Agarose Gel – Oly gDNA for BS-seq Libraries, Take Two

The gel I ran earlier today looked real rough, due to the fact that I didn’t bother to equalize loading quantities of samples (I just loaded 1μL of all samples regardless of concentration). So, I’m repeating it using 100ng of DNA from all samples.

Additionally, this gel also includes C.gigas samples that Katie Lotterhos sent to us to see how they look.

Ran a 0.8% agarose, low-TAE gel, stained with ethidium bromide.

Results:

 

Look at that! The samples look MUCH nicer when they’re not overloaded and uniformly loaded!

Most have a prominent high molecular weight band (the band that’s closes to the top of the ladder, not the DNA visible in the wells). All exhibit smearing, but 2NF1 shows a weird accumulation of low molecular weight DNA.

Katie’s C.gigas samples (M1, M2, M3) look similar to the Olympia oyster gDNA, however her samples appear to have residual RNA in them (the fuzzy band ~500bp).

Will discuss with Steven which samples he wants to use for bisulfite treament and library construction.

Share

Agarose Gel – Oly gDNA for BS-seq Libraries

Ran 1μL of each sample from yesterday’s DNA isolation on a 0.8% agarose, low-TAE gel, stained with ethidium bromide.

 

Results:

 

 

Since I didn’t load equal quantities of DNA, the intensities across the various samples is highly variable.

Those samples with high degree of smearing are also those with the highest concentrations. Thus, one would expect to be able to visualize a greater range of DNA sizes in a gel (because more DNA is present). Notice the samples with nice, high molecular weight bands and little smearing (1NF16, 1NF17). These are less than half the concentrations of all the samples that exhibit extensive smearing (2NF3, 2NF8, 1NF12). So, I think all samples will be fine for proceeding with bisulfite conversion and subsequent library construction.

However, I should re-run this gel using equalized DNA quantities for all samples…

 

Share

DNA Quality Assessment – Geoduck & Olympia Oyster gDNA

Have three separate sets of geoduck & olympia oyster gDNA that need to be run on gels before sending to BGI for genome sequencing:

GEODUCK

 

OLYMPIA OYSTER

 

Ran 100ng of each sample on a 0.8% agarose 1x modified TAE gel w/EtBr.

Results:

 

All the samples from both sets appear to be overloaded. Overloading is generally seen as the streaking seen immediately above each band.

GEODUCK

Overall, the samples look pretty good. Sadly, the worst of the three (due to the most smearing – i.e. degradation) appears to be the DNA extracted using the E.Z.N.A. Mollusc Kit (Omega BioTek).

Also of note are the two bands present in the DNAzol sample. These bands are likely ribosomal RNA because I neglected to perform a RNase treatment during the extraction. Doh!

 

OLYMPIA OYSTER

None of them are particularly great. Just like the geoduck set, the worst of the three came from the E.Z.N.A Mollusc Kit (Omega BioTek).

Also, just like the geoduck set, there are two bands present in the DNAzol sample. These bands are likely ribosomal RNA because I neglected to perform a RNase treatment during the extraction. Doh!

The phenol-chloroform clean up sample is either jacked up or severely overloaded, based on the crazy streaking that’s present. However, this sample looked similar after the initial extraction on 20151113.

 

I will send these samples separately (i.e. will not pool them into single samples) to BGI to run QC and, hopefully, add them to the DNA they already have to complete the genome sequencing for these two projects.

Share

DNA Quality Assessment – Geoduck, Oly & Oly 2SN

I recently ran gDNA isolated for geoduck and Olympia oyster genome sequencing, as well as gDNA isolated from the Olympia oyster reciprocal transplant experiment out on a Bioanalyzer (Agilent) using the DNA 12000 chips. The results from the chip were a bit confusing and difficult to assess exactly what was going on with the DNA.

So, I ran 5μL of each of those samples on a 0.8% agarose 1x modified TAE gel w/EtBr to get a better look at how the samples actually looked.

Results:

 

Both the geoduck and the Olympia oyster samples for genome sequencing show intact, high molecular weight bands with some smearing (i.e. degradation). The oly sample looks a bit funky, most likely due to a gel anomaly. I’ll quantify these using a dye-based method for a more accurate quantification before sending off to BGI.

The Fidalgo 2SN samples all have intact, high molecular weight bands, but most of the samples show extensive smearing (i.e. degradation). However, sample 2SN 35 has no visible DNA at all.

Here’s a table highlighting the differences between the Fidalgo gDNA samples:

Sample Fresh/Frozen Isolator
10 Fresh Sam
11 Fresh Sam
12 Fresh Sam
20 Fresh Mrunmayee
21 Fresh Mrunmayee
22 Fresh Mrunmayee
32 Frozen Sam
33 Frozen Sam
34 Frozen Sam
35 Frozen Sam

 

The fresh ctenidia samples were isolated by me on 20151021 and by Mrunmayee on 20151023. The frozen ctenidia samples were isolated by me on 20151103.

It’s interesting to note that Mrunmayee’s isolations appear to exhibit the least amount of degradation. Besides her handling the samples, the primary difference is that her samples were incubated in the buffer/Pro K solution O/N @ 37C, while my fresh samples were incubated @ 60C for 3hrs and my frozen samples were incubated @ 60C for 1hr. Overall, though, the frozen samples look the worst.

Finally, it’s also interesting to see that the two samples isolated using DNazol (geoduck and Olympia oyster genome samples) migrate more slowly than the remaining Olympia oyster samples which were isolated with the E.Z.N.A. Mollusc Kit.

Share

PCR – Oly RAD-seq Test-scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.

Prior to generating full-blown libraries, we needed to run a “test-scale” PCR to identify the minimum number of cycles needed to produce the intended product size (166bp).

I ran PCR reactions on a subset (Sample #: 2, 3, 17, & 30) of the 10 samples that I performed adaptor ligations on 20151029.

PCR reactions were set up on ice in 0.5mL PCR tubes.

REAGENT SINGLE REACTION (μL) x4.4
Template 8 NA
NanoPure H2O 1 4.4
dNTPs (1mM) 4 17.6
ILL-LIB1 (10μM) 0.4 1.76
ILL-LIB2 (10μM) 0.4 1.76
ILL-HT1 (1μM) 1 4.4
ILL-BC1 (1μM) 1 4.4
5x Q5 Reaction Buffer 4 17.6
Q5 DNA Polymerase 0.2 0.88
TOTAL 20 52.8

 

Combined 12μL of master mix with 8μL of the ligation reaction from earlier today.

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
27 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

We’re following the “1/4 reduced representation” aspect of the protocol. As such, 5μL of each reaction was pulled immediately after the extension (72C – machine was paused) of cycles 12, 17, 22, & 27 in order to determine the ideal number of cycles to use. Also ran the ligation reactions (labeled “Ligations” on the gel below) of the samples as a pre-PCR comparison. Treated them the same as the PCR reactions: mixed 8μL of the ligation with 12μL of H2O, used 5μL of that mix to load on gel.

These samples were run on a 1x modified TAE 1.2% agarose gel (w/EtBr).

 

Results:

Gel image denoting sample numbers within each cycle number. Green arrow indicates the expected migration of our target band size of 166bp.

Looks like cycle 17 is the minimum cycle number with which we begin to see a consistent ~166bp band. Will continue on with the “prep-scale” PCR using 17 cycles.

Share

PCR – RLOv Clones

Colony PCRs were performed on each of the transformations from 20151015 (RLOv_ DNA_helicase, RLOv_head_to_tail, RLOv_membrane_gene_1, RLOv_membrane_gene_2, RLOv_tail_to_fiber) to confirm successful ligations in plasmid pCR2.1 using the M13F/R vector primers.

Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp100+x-gal plate and then used to inoculate the respective PCR reactions.

Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Master mix calcs are here (Google Sheet): 20151019 – Colony PCRs RLOv

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

 

All the PCRs look good. All white colonies selected contain a PCR product of appropriate size (i.e. larger than the blue colonies; negative [-C] control). Will select clones #1 from each to grow up for plasmid prep.

Share