Tag Archives: oly

No code required

Today Sam and I took care of the daily maintenance of F2 Olympia oysters grown at the Ken Chew Shellfish Hatchery at Manchester, WA. In short, larvae are being described from Fidalgo (North: NF), Oyster Bay (South: SS), and Hood Canal (HC) broodstock. Though I had done most aspects before, never without Katherine, thus she provided instructions.

When I arrived the algae tank was empty and pump was off.
IMG_2915_JPG__9_documents__9_total_pages__1B651C27.png
The system was flushed with freshwater (with Sam soaked with said water) along with bleach. The algae tank was filled. The first set of tanks that were processed were the larger larvae (+160um).
Banners_and_Alerts_1B651CE0.png
Using 100um screen larvae were collected, brought up in 800ml and 0.5ml (x3) taken for counts.
IMG_2922_JPG__9_documents__9_total_pages__1B651D6C.png
The remaining larvae were placed back into cleaned systems.

Next, the smaller larvae tanks were processed, using 160 over 100 um screens, with larger ones moving over to +160um tanks (above). For this counts were done for both size classes and DNA samples taken for 160 size class. The smaller larvae placed back in the same tanks.
Banners_and_Alerts_and_IMG_2919_JPG__9_documents__9_total_pages__1B651E4B.png
For DNA samples, 4mls of larvae from 800ml beaker were taken, rinsed with ethanol and placed in 1.5ml centrifuge tube with 1ml of RNAlater (This was also done with fresh larvae- below).
Banners_and_Alerts_1B651F19.png

The last systems tackled were the “new”, fresh larvae from collectors..
oly_1B651FB8.png
For this, larvae were captured using 200um / 100um screen, with larvae moved to larger tanks, counts done, and samples collected for DNA. As expected very little larvae, they were brought up in 400ml, 1ml used for counting, and 8ml used for DNA samples.
Banners_and_Alerts_1B652044.png

Sam counted the larvae, probably still very wet (Sam and the larvae).
sam_1B652232.png

And here are the counts!
IMG_2923_JPG__9_documents__9_total_pages__1B6520EF.png

Share

Passing Flanks

A first look at population differences at qPCR primer sites for three population of Olympia oysters


Plate 1 (samwhite_112381) included, BMP2, CARM, HSPb11, and PGEEP4. At the bottom is a full list of qPCR primers.

BMP2

Limited coverage

CARM

Better coverage

conflicts were ambigs (ie S,W,R)

HSPb11

Missed qPCR primer (R did not seem to work)

PGEEP4

Nothing assembled – everything under 100 bp.


Plate 2 (samwhite_112404) included, H2A, H2AV, p291N, CRAF, GABABR, GRB2, H3-3

H2A

comp23253_c0_seq1
One primer not covered

H2AV

comp25000_c0_seq1
Not much coverage

p291N

comp22144_c0_seq1
Not much coverage

CRAF

comp25313_c0_seq1
Decent coverage, only conflict = ambig, SNP!

SNP

GABABR

comp19002_c0_seq1
Great coverage, did find some SNPs. Missed qPCR primer

SNPs

GRB2

comp10127_c0_seq1
Not great coverage

H3-3

comp19571_c0_seq1


List of QPCR Primers

QPCR Primer sequence Protein
HSP70c_FWD AGGAAAGGTCGGGAGAGGAA Heat shock 70 kDa protein 12A
HSP70c_REV ACCTCGGACTTTGGACGAAC Heat shock 70 kDa protein 12A
p29ING4_FWD TACCTTTGGGCTTCACCGTC Inhibitor of growth protein 4 (p29ING4)
p29ING4_REV GTCCATCACACACCCCTCAG Inhibitor of growth protein 4 (p29ING4)
CerS2_FWD TTGTCGGTCTCCTCCTGCTA Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
CerS2_REV CCGTCTTCTGAGCCATCGTT Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
GABABR1_FWD CCGAGGAGGACACGAAACTC Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
GABABR1_REV CGGACAGGTTCTGGATTCCG Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
HSP70d_FWD TTTGTCTCACCGGCTTTGTG Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B’)
HSP70d_REV GACATGAGACCAAAGACGCC Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B’)
THRa_FWD GACACTATCCTCACTCGGCG Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
THRa_REV GGGTGCCGAGTAAACAAGGA Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
Defensin_FWD TCTAGCGGAGTTTGTTGGGG Big defensin
Defensin_REV ATGGCTGTCGGAGGAGGATT Big defensin
GRB2_FWD AACTTTGTCCACCCAGACGG Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
GRB2_REV CCAGTTGCAGTCCACTTCCT Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
H3.3_FWD CACGCTCTCCTCGAATCCTC Histone H3.3
H3.3_REV AAGTTGCCTTTCCAGCGTCT Histone H3.3
H2A.V_FWD TGCTTTCTGTGTGCCCTTCT Histone H2A.V (H2A.F/Z) (Fragment)
H2A.V_REV TATCACACCCCGTCACTTGC Histone H2A.V (H2A.F/Z) (Fragment)
H2A_FWD GCTGGGGTTTTTCTGGGTCT Histone H2A
H2A_REV GGAACTACGCCGAGAGAGTG Histone H2A
Hspb11_FWD ATGTTTCCTGGTCTCCGTCA Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
Hspb11_REV CATCAACGCCAGGGGAACTT Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
GDF-8_FWD CCGTGGATGTCGCAGAAAGA Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
GDF-8_REV CTGCTTTCTCCGTCCCCTTT Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
HSP70b_FWD AAGTACCTTGGGGAGCTTGC Heat shock 70 kDa protein 12B
HSP70b_REV TCCACAGACTTTCCTCCCCA Heat shock 70 kDa protein 12B
GRP-78_FWD GAGAAACCACGCAGGGAGAA 78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
GRP-78_REV CATCAGCATCGAAGGCAACG 78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
CARM1_FWD TGGTTATCAACAGCCCCGAC Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
CARM1_REV GTTGTTGACCCCAGGAGGAG Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
BMP-2_FWD TGAAGGAACGACCAAAGCCA Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
BMP-2_REV TCCGGTTGAAGAACCTCGTG Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
PGE/EP4_FWD ACAGCGACGGACGATTTTCT Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
PGE/EP4_REV ATGGCAGACGTTACCCAACA Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
CRAF1_FWD AGCAGGGCATCAAACTCTCC TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
CRAF1_REV ACAAGTCGCACTGGCTACAA TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
NFKBina_FWD GATGGCGGTGCATGTGTTAG NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
NFKBina_REV CGAGGAGAACCTTGTGCAGT NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
PGRP-S_FWD GAGACTTCACCTCGCACCAA Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
PGRP-S_REV AACTGGTTTGCCCGACATCA Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
TLR2.1_FWD ACAAAGATTCCACCCGGCAA Toll-like receptor 2 type-1
TLR2.1_REV ACACCAACGACAGGAAGTGG Toll-like receptor 2 type-1
GDF-8b_FWD AACTGATTCTGCTCGTCGCA Growth/differentiation factor 8 (GDF-8) (Myostatin)
GDF-8b_REV TGTTCTTCCACCCACCACTG Growth/differentiation factor 8 (GDF-8) (Myostatin)
Share