Tag Archives: OsHV

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Share