Tag Archives: OsHV_ORF117_F/R

PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share