Tag Archives: pCR2.1

Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

The last run at this failed, but I think that was due to old ampicillin stocks; leading to no selective pressure for transformants that actually contained plasmid.

I’ve since remedied that.

Grew up 5mL of culture from the only two transformants in 1xLB + 100ug/mL of (fresh!) ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 3mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 10uL of sample.

Results:

Quantification (Google Sheet): 20170817_quantification_oshv_orf117_plasmid

Colony 1 – 130ng/uL
Colony 2 – 148ng/uL

Yields look perfect. Will submit for sequencing at Genewiz (they need 10uL of ~50ng/uL DNA) and see what we have here…

Share

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

Yesterday’s transformation with freshly prepared ampicillin didn’t produce any transformants, suggesting the DNA concentration is too low.

Previously, I tried to elute the DNA from one of the spots Tim sent with 50uL. This volume was enough to soak the Whatman paper and produce excess liquid. In retrospect, I think the volume was too large and diluted the DNA too much (concentration wasn’t measurable via Qubit)

Today, I eluted with 25uL. Since this volume was too little to produce excess liquid, I created a spin “filter” to extract the absorbed liquid. Briefly, I punctured the top and bottom of a 0.5mL snap cap tube with an 18 gauge needle, inserted the Whatman paper disc into this tube, and then put this tube in a 2mL snap cap tube. This assembly was spun @ 18,000g RT for 3 mins.

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

Wow, only two colonies! Well, as they say, you only need one. Will PCR, re-streak, and inoculate 5mL liquid cultures to see if either of these colonies seem to have the insert.

Share

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

This is a repeat since the previous attempt at obtaining sufficient quantities of plasmid for sequencing failed. Although I’m not sure why, I figure it’s easy enough to re-do using ampicillin stocks that aren’t many years old. :)

The old ampicillin may not have been strong enough to put enough selective pressure on transformants, which possibly led to such little plasmid recovery.

I prepared fresh ampicillin solution (20mg/mL) and made new LB plates (ampicillin concentration 100ug/mL).

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

No transformants. So, this suggests that the original ampicillin was bad. Now, the lack of transformants suggests the plasmid concentration is too low. Will try eluting the DNA from the second spot of Whatman paper.

Share

Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

Grew up 5mL of culture from re-streaked colony #1 in 1xLB + 100ug/mL of ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 5mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 1uL of sample.

Results:

The results are not good. Using 1uL of the sample, I received an error message that the concentration was out of range – too low!

Repeated, but used 10uL of sample. Concentration was displayed as 1.13ng/uL!!

This is insufficient yield/concentration for sequencing.

It’s possible that the kit is too old (no receipt date marked on the box…)? The reagents shouldn’t go bad, but can the columns? I feel like the resins in the columns are pretty stable, just like the various buffers.

The ridiculously low yields could also possibly indicate that the bacteria don’t actually have the plasmid, but PCRs from yesterday suggest otherwise.

Maybe the column was overloaded? I’ll repeat this next week, but using smaller culture size and/or not using the column and perform an isopropanol precipitation instead…

And/or make fresh stock of ampicillin (current stock is many years old, but has been frozen).

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

Restriction Digestions – pCR2.1/RLOv Plasmids

Set up restriction digestions to linearize the pCR2.1/RLOv plasmids in preparation for ISH probes and qPCR standard curves. Used BamHI (NEB), since it doesn’t cut in any of the RLOv sequences and cuts one time in pCR2.1-TOPO (Invitrogen).

PLASMID Vol for 1.5μg (μL) H2O to 40μL
pCR2.1/RLOv_DNA_helicase 21.4 18.6
pCR2.1/RLOv_head_to_tail 11.1 28.9
pCR2.1/RLOv_membrane_gene_1 12.2 27.8
pCR2.1/RLOv_membrane_gene_2 14.3 25.7
pCR2.1/RLOv_tail_fiber 20 20

 

Digestion Master Mix

REAGENT SINGLE REACTION (μL) x 5.5 (μL)
Plasmid 40 NA
10x Buffer 3.1 (NEB) 5 27.5
BamHI (NEB) 1 5.5
H2O 4 22
TOTAL 50 Add 10μL to each tube

Digests were incubated at 37C for 1hr in PTC-200 thermal cycler (MJ Research); no heated lid.

Ran 3μL of undigested plasmid and 10μL of linearized plasmid on 0.8% agarose 1x TBE gel stained w/EtBR.

Results:

Hyperladder I (Bioline)

U = Undigested; Bam = BamHI digest

Besides the funky way this gel ran, the digests look to be complete.

Will quantify remaining linearized plasmids with a dye-based method for accurate quantification and then proceed with the making ISH probes (membrane genes and tail fiber gene) or qPCR standard curves (DNA helicase and head-to-tail).

 

Share

Sanger Sequencing Submission – pCR2.1/RLOv Clones

Submitted the pCR2.1/RLOv clones from earlier this week for Sanger sequencing to Genewiz (order #10-313205054).

Submitted ~500ng of each plasmid in a final volume of 15μL (including primer). Each clone will be sequenced from each direction with M13F (-21) (25pmol; 2.5μL of 10μM stock) and M13R primers (25pmol; 2.5μL of 10μM stock) for a total of 10 sequencing reactions:

  • SW01    RLOv_DNA_Helicase-M13F_-21_
  • SW02    RLOv_head_to_tail-M13F_-21_
  • SW03    RLOv_membrane_gene_1-M13F_-21_
  • SW04    RLOv_membrane_gene_2-M13F_-21_
  • SW05    RLOv_tail_fiber-M13F_-21_
  • SW06    RLOv_DNA_Helicase-M13R
  • SW07    RLOv_head_to_tail-M13R
  • SW08    RLOv_membrane_gene_1-M13R
  • SW09    RLOv_membrane_gene_2-M13R
  • SW10    RLOv_tail_fiber-M13R
Share

Plasmid Isolation – RLOv pCR2.1 Clones

Clone #1 was selected from each of the screened clones.

A sterile pipette tip was used to inoculate 5mL of 1x LBAmp100 in a 15mL conical tube. The tubes were incubated O/N @ 37C on a rocker.

3mL of liquid culture was used as input for plasmid isolation with the QIAprep Spin Mini Kit (Qiagen) according to the manufacturer’s protocol.

1mL of each culture was combined with 1mL of 50% sterile glycerol (25% glycerol final concentration) and stored @ -80C with existing bacterial stocks.

Plasmid DNA was eluted with 50μL of Buffer EB and quantified on the Roberts Lab NanoDrop1000 (ThermoFisher) in order to have a rough idea of concentrations to submit for Sanger sequencing. A dye-based quantification will be performed after sequencing results are back in order to obtain a more accurate assessment for use in ISH and/or qPCR standard curve creation.

Results:

Quality (260/280 & 260/230 ratios) look great and yields are more than sufficient. Will prep samples for Sanger sequencing.

Share