Tag Archives: phage

Sanger Sequencing Submission – pCR2.1/RLOv Clones

Submitted the pCR2.1/RLOv clones from earlier this week for Sanger sequencing to Genewiz (order #10-313205054).

Submitted ~500ng of each plasmid in a final volume of 15μL (including primer). Each clone will be sequenced from each direction with M13F (-21) (25pmol; 2.5μL of 10μM stock) and M13R primers (25pmol; 2.5μL of 10μM stock) for a total of 10 sequencing reactions:

  • SW01    RLOv_DNA_Helicase-M13F_-21_
  • SW02    RLOv_head_to_tail-M13F_-21_
  • SW03    RLOv_membrane_gene_1-M13F_-21_
  • SW04    RLOv_membrane_gene_2-M13F_-21_
  • SW05    RLOv_tail_fiber-M13F_-21_
  • SW06    RLOv_DNA_Helicase-M13R
  • SW07    RLOv_head_to_tail-M13R
  • SW08    RLOv_membrane_gene_1-M13R
  • SW09    RLOv_membrane_gene_2-M13R
  • SW10    RLOv_tail_fiber-M13R
Share

Plasmid Isolation – RLOv pCR2.1 Clones

Clone #1 was selected from each of the screened clones.

A sterile pipette tip was used to inoculate 5mL of 1x LBAmp100 in a 15mL conical tube. The tubes were incubated O/N @ 37C on a rocker.

3mL of liquid culture was used as input for plasmid isolation with the QIAprep Spin Mini Kit (Qiagen) according to the manufacturer’s protocol.

1mL of each culture was combined with 1mL of 50% sterile glycerol (25% glycerol final concentration) and stored @ -80C with existing bacterial stocks.

Plasmid DNA was eluted with 50μL of Buffer EB and quantified on the Roberts Lab NanoDrop1000 (ThermoFisher) in order to have a rough idea of concentrations to submit for Sanger sequencing. A dye-based quantification will be performed after sequencing results are back in order to obtain a more accurate assessment for use in ISH and/or qPCR standard curve creation.

Results:

Quality (260/280 & 260/230 ratios) look great and yields are more than sufficient. Will prep samples for Sanger sequencing.

Share

Cloning – Purified Abalone RLOv PCR Products

Purified PCR products from 20151008 (in situ hybridization [ISH] primers) & 20151009 (qPCR primers) RLOv primers were used for cloning. The qPCR primers are intended to develop a qPCR standard curve and the ISH primers are intended to develop three ISH probes.

  • RLOv_DNA_helicase (for qPCR)
  • RLOv_head_to_tail_gene (for qPCR)
  • RLOv_membrane_gene_1 (for ISH)
  • RLOv_membrane_gene_2 (for ISH)
  • RLOv_tail_fiber_gene (for ISH)

The PCR products were separately ligated using The Original TA Cloning Kit (Invitrogen).

LIGATIONS

REAGENT SINGLE REACTION VOL (μL) x 5.5
Purified PCR 5 NA
10x Ligase Buffer 1 5.5
pCR2.1 Vector 2 5.5
H2O 1 5.5
T4 DNA Ligase 1 5.5
TOTAL 10 22

Ligation reactions were set up on ice.Combined 5μL of purified PCR product with 5μL of ligation master mix in a 1.5mL snap cap tube. Incubated 24hrs @ RT.

 

TRANSFORMATIONS

50μL of X-gal (20mg/mL) was added to a LB-Amp100 plates, spread and warmed @ 37C.

Five vials of OneShot TOP 10 chemically competent cells (Invitrogen) were thawed on ice. 3μL of the ligation reaction was added to the cells, gently mixed and incubated on ice for 5mins. 50μL of cells were transferred to the LB-Amp100+X-gal plates, spread and incubated O/N at 37C.

Share

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

Share

qPCR – RLOv Specificity Check

After yesterday’s confirmation that the primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv (and don’t amplify RLO alone), I needed to confirm that the qPCRs only generated a single product in each reaction via melt curve analysis.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

NOTE: Remaining volume of template DNA wasn’t going to be sufficient for all reactions, so added 100μL of NanoPure H2O. Seeing how early the amplification was in yesterday’s qPCR (Cq ~15), this dilution should be fine.

All samples were run in duplicate.

Master mix calcs are here: 20151009 – qPCR RLOv

Plate layout, cycling params, etc can be found in the qPCR Report (see Results).

Results:
qPCR Report (PDF): Sam_2015-10-09 12-36-54_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-10-09 12-36-54_CC009827.pcrd

Both primer sets amplified a single PCR product. This is demonstrated by the single melt peak for each primer set.

Share

qPCR – New Withering Syndrome Phage Primers

Ran qPCR with the newly designed primers and probes for the following targets:

  • DNA Helicase (RLOv)
  • Head-to-tail gene (RLOv)
  • WSN1 (RLO)

Template DNA used:

In the histology scoring pictures below, the “New” column refers to histology scores for the presence of the phage. A score = 0 means no phage.

  • 06:5-6 (RLO only)

  • 06:6-54 (RLOv)

  • UW08:22-11A (naive pinto abalone; no RLO)

 

Master mix calcs are here: 20151008 – qPCR WS phage

All samples were run in duplicate. Cycling params, plate layout, etc. can be seen in the qPCR Report (see below).

Results:

qPCR Report (PDF): Sam_2015-10-08 17-45-38_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-10-08 17-45-38_CC009827.pcrd

ORANGE – WSN1; BLUE – DNA Helicase; GREEN – Head-to-tail

The results look great! The two RLOv (phage) primer sets only amplify in the sample that has histological confirmation of the presence of phage (06:6-54). They do not amplify in the RLO-only (no phage; 06:5-6) sample, demonstrating that these two primer sets are indeed specific to the phage and don’t  amplify the RLO.

The withering syndrome primers (WSN1) were run to confirm that there aredetectable levels of RLO in both the RLOv & RLO samples, to further support the evidence showing the specificity of the two phage primer sets.

Will use the two RLOv primer sets in a conventional PCR for cloning/sequencing and development and validation of a qPCR standard curve.

Share

Agarose Gel – Phage ISH Primers PCRs

Ran PCR products from yesterday on a 1% agarose 1x TBE gel, stained with ethidium bromide.

Results:

IMPORTANT NOTE: The negative control sample should actually be labelled UW08:22-11A.

 

PRIMER SET EXPECTED PCR SIZE (bp) RESULT SIZE (bp)
RLOv_membrane_gene_1 401 ~400bp
RLOv_membrane_gene_2 318 ~400bp
RLOv_tail_fiber_gene 451 ~500bp

PCR looks great. Excellent amplification in the RLO positive samples (06:6-54), with no amplification in the negative controls (UW08:22-11A) nor in the no template controls (NTC).

Excised the bands from each of the RLOv positive samples (see gel image below) and purified the DNA using UltrafreeDA Spin Columns (Millipore) according to the manufacturer’s protocol. DNA was stored @ 4C for cloning/labelling/sequencing at a later date.

Gel image showing excised regions.

Share

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

Share

Primer-BLAST – Withering Syndrome Phage Primers for qPCR & ISH

After designing new primers for use in Withering Syndrome phage (RLOv) identification on 20150706, ran Primer-BLAST via NCBI’s website to assess primer specificity. Ran Primer-BLAST with each primer set against the NCBI nr Viruses (Tax ID:10239 ) and Prokaryotes (Tax ID: 2) nucleotide databases. Excluded uncultured/environmental samples from the databases. The general setting for the Primer-BLASTs can be seen in the screen capture below. Entered in each primer set in the “Primer Parameters” boxes.

The Primer-BLAST only exhibits an output if either of the primers produce a match. When primers do have a match in the database, an alignment of primer(s) is shown on the matching template. Dots in the alignment are exact nucleotide matches, whereas mismatched nucleotides are simply displayed with their corresponding letter in the alignment.

Results:

qPCR Primers

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG


ISH Primers

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

This shows some matching to a single template and only with the forward primer. It should be fine to use for ISH.

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

The forward primer and the reverse primer show some matching, but those matches exist in two different species. As such, these primers should be fine for use in ISH.

Share

Primer Design – Withering Syndrome Phage for qPCR & ISH

Stan Langevin recently annotated the Withering Syndrome (WS) bacteriophage genome he previously assembled. Additionally, after discussing with Carolyn, they decided on two new potential qPCR targets and three potential in-situ hybridization (ISH) targets. Stan provided a FASTA file with the five sequences and primers were designed using Primer3Plus.

For qPCR primers, amplicon length range was set to 150-250bp. Additionally, I had Primer3Plus design an internal primer for potential future use as a fluorescent probe, should we ever establish one of these qPCRs as a validated WS phage assay.

The ISH primers amplicon length range was set to 400-500bp.

All primers (excluding probes) will be ordered from IDT.


qPCR

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA
Probe: TGCGCATGCTATCCATGGAAACA

 

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG
Probe: GCCTGTGATCTCAAACAACGCTGC


 

ISH

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

 

 

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

Share