Tag Archives: Primer3Plus

Primer Design – Withering Syndrome Phage for qPCR & ISH

Stan Langevin recently annotated the Withering Syndrome (WS) bacteriophage genome he previously assembled. Additionally, after discussing with Carolyn, they decided on two new potential qPCR targets and three potential in-situ hybridization (ISH) targets. Stan provided a FASTA file with the five sequences and primers were designed using Primer3Plus.

For qPCR primers, amplicon length range was set to 150-250bp. Additionally, I had Primer3Plus design an internal primer for potential future use as a fluorescent probe, should we ever establish one of these qPCRs as a validated WS phage assay.

The ISH primers amplicon length range was set to 400-500bp.

All primers (excluding probes) will be ordered from IDT.


qPCR

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA
Probe: TGCGCATGCTATCCATGGAAACA

 

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG
Probe: GCCTGTGATCTCAAACAACGCTGC


 

ISH

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

 

 

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

Share