Tag Archives: PTC-200

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Share

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

Share

Reverse Transcription – Water Filter DNased RNA (from 20161207)

Performed reverse transcription on the DNased RNA samples that I verified were free of detectable RLO DNA (20161207).

Combined 17μL DNased RNA + 0.5μL random primers (Promega; Cat: C1181) in 0.2mL PCR tubes.

NOTE: The 17μL was virtually all of the sample volume recovered from DNasing. As such, the DNased RNA will not be quantified.

Incubated DNased RNA and primer mix in PTC-200 thermal cycler (MJ Research) at 70C for 5mins w/heated lid, then immediately placed on ice.

Created master mix of following components:

REAGENT SINGLE REACTION VOL (μL) NUMBER REACTIONS TOTAL VOL (μL)
5x MMLV RT BUFFER 5 14 70
10mM dNTPS (Promega) 1.25 14 17.5
MMLV RT (Promega) 0.5 14 7

Added 6.75 of master mix to each and mixed by pipetting.

Incubated PTC-200 thermal cycler (MJ Research) @ 37C for 1hr (no heated lid), followed by 95C for 3mins (heated lid). Samples were transferred to 0.5mL snap cap tubes and labelled with “cDNA” and the corresponding sample name. Samples will be stored in my -20C box.

UPDATE 20170830 Lisa has moved these samples to a -20C box dedicated to RLO Viability cDNA.

Share

Bisulfite Treatment – Oly Reciprocal Transplant DNA & C.gigas Lotterhos DNA for BS-seq

After confirming that the DNA available for this project looked good, I performed bisulfite treatment on the following gDNA samples:

  • 1NF11
  • 1NF15
  • 1NF16
  • 1NF17
  • 2NF5
  • 2NF6
  • 2NF7
  • 2NF8
  • NF2_6
  • NF2_18
  • M2
  • M3

Sample names breakdown like this:

1NF#

1 = Fidalgo Bay outplants

NF = Fidalgo Bay broodstock origination

= Sample number

2NF#

Same as above, but:

2 = Oyster Bay outplants

NF2_# (Oysters grown in Oyster Bay; DNA provided by Katherine Silliman)

NF2 = Fidalgo Bay broodstock origination, family #2

= Sample number

M2/M3 = C.gigas from Katie Lotterhos

 

Followed the guidelines of the TruSeq DNA Methylation Library Prep Guide (Illumina).

Used the EZ DNA Methylation-Gold Kit (ZymoResearch) according to the manufacturer’s protocol with the following changes/notes:

  • Used 100ng DNA (per Illumina recs; Zymo recommends at least 200ng for “optimal results”).
  • Thermal cycling was performed in 0.5mL thin-wall tubes in a PTC-200 (MJ Research) using a heated lid
  • Centrifugations were performed at 13,000g
  • Desulphonation incubation for 20mins.

DNA quantity calculations are here (Google Sheet): 20151218_oly_bisulfite_calcs

Samples were stored @ -20C. Will check samples via Bioanalyzer before proceeding to library construction.

Share

PCR – Oly RAD-seq Prep Scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.
After determining the minimum number of PCR cycles to run to generate a visible, 166bp band on a gel yesterday, ran a full library “prep scale” PCR.

 

REAGENT SINGLE REACTION (μL) x11
Template 40 NA
ILL-HT1 (1μM) 5 55
ILL-BC# (1μM) 5 NA
NanoPure H2O 5 55
dNTPs (1mM) 20 220
ILL-LIB1 (10μM) 2 22
ILL-LIB2 (10μM) 2 22
5x Q5 Reaction Buffer 20 220
Q5 DNA Polymerase 1 11
TOTAL 100 550

 

Combined the following for PCR reactions:

  • 55μL PCR master mix
  • 40μL ligation mix
  • 5μL of ILL-BC# (1μM) – The barcode number and the respective sample are listed below.

 

SAMPLE BARCODE SEQUENCE
Oly RAD 02  1  CGTGAT
Oly RAD 03  2  ACATCG
Oly RAD 04  3  GCCTAA
Oly RAD 06  4  TGGTCA
Oly RAD 07  5  CACTGT
Oly RAD 08  6  ATTGGC
Oly RAD 14  7  GATCTG
Oly RAD 17  8  TCAAGT
Oly RAD 23  9  CTGATC
Oly RAD 30 10 AAGCTA

 

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
17 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

 

After cycling, added 16μL of 6x loading dye to each sample.

Loaded 10μL of ladder on each of the two gels.

Results:

 

Things looked fine. Excised the bands from each sample indicated by the green arrow. Before and after gel images show regions excised. Will purify the bands and quantify library yields.

Share

PCR – Oly RAD-seq Test-scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.

Prior to generating full-blown libraries, we needed to run a “test-scale” PCR to identify the minimum number of cycles needed to produce the intended product size (166bp).

I ran PCR reactions on a subset (Sample #: 2, 3, 17, & 30) of the 10 samples that I performed adaptor ligations on 20151029.

PCR reactions were set up on ice in 0.5mL PCR tubes.

REAGENT SINGLE REACTION (μL) x4.4
Template 8 NA
NanoPure H2O 1 4.4
dNTPs (1mM) 4 17.6
ILL-LIB1 (10μM) 0.4 1.76
ILL-LIB2 (10μM) 0.4 1.76
ILL-HT1 (1μM) 1 4.4
ILL-BC1 (1μM) 1 4.4
5x Q5 Reaction Buffer 4 17.6
Q5 DNA Polymerase 0.2 0.88
TOTAL 20 52.8

 

Combined 12μL of master mix with 8μL of the ligation reaction from earlier today.

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
27 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

We’re following the “1/4 reduced representation” aspect of the protocol. As such, 5μL of each reaction was pulled immediately after the extension (72C – machine was paused) of cycles 12, 17, 22, & 27 in order to determine the ideal number of cycles to use. Also ran the ligation reactions (labeled “Ligations” on the gel below) of the samples as a pre-PCR comparison. Treated them the same as the PCR reactions: mixed 8μL of the ligation with 12μL of H2O, used 5μL of that mix to load on gel.

These samples were run on a 1x modified TAE 1.2% agarose gel (w/EtBr).

 

Results:

Gel image denoting sample numbers within each cycle number. Green arrow indicates the expected migration of our target band size of 166bp.

Looks like cycle 17 is the minimum cycle number with which we begin to see a consistent ~166bp band. Will continue on with the “prep-scale” PCR using 17 cycles.

Share

Adaptor Ligation – Oly AlfI-Digested gDNA for RAD-seq

Continued to follow the 2bRAD protocol (PDF) developed by Eli Meyer’s lab.

Digested DNA from yesterday was heat inactivated for 10mins @ 65C and was not run out on a gel due to the fact that the input gDNA was degraded and a shift in the high molecular weight band (indicating the digestion was successful) would not exist because a high molecular weight band is absent in these samples.

 

Anneal Adaptors

After preparing the two adaptors below, they were incubated for 10mins @ RT:

  • Adaptor 1 (2μM final concentration of each oligo): 1.5μL of 5ILL-NR (100μM) + 1.5μL of anti-ILL (100μM) + 72μL H2O = 75μL total
  • Adaptor 2 (2μM final concentration of each oligo): 1.5μL of 3ILL-NR (100μM) + 1.5μL of anti-ILL (100μM) + 72μL H2O = 75μL total

After annealing, the adaptors were stored on ice.

 

Adaptor Ligation

All components were stored on ice. Ligation reactions were prepared on ice and performed in 0.5mL snap cap tubes.

REAGENT SINGLE REACTION (μL) x11
Digested DNA 10 NA
ATP (10mM) 1 11
10x T4 Ligase Buffer 4 44
Adaptor 1 (2μM) 5 55
Adaptor 2 (2μM) 5 55
T4 DNA Ligase 1 11
NanoPure H2O 24 264
TOTAL 50 440

Combined 40μL of the master mix with 10μL of AlfI-digested DNA in a 0.5mL snap cap tube.

Incubated ligation reaction @ 16C O/N in PTC-200 thermal cycler (MJ Research) – no heated lid.

Ligations will be stored @ -20C until I can continue working with them on Tuesday.

Share

PCR – Oly RAD-seq Prep Scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.

After determining the minimum number of PCR cycles to run to generate a visible, 166bp band on a gel yesterday, ran a full library “prep scale” PCR.

 

REAGENT SINGLE REACTION (μL) x11
Template 40 NA
ILL-HT1 (1μM) 5 NA
ILL-BC# (1μM) 5 NA
NanoPure H2O 5 55
dNTPs (10mM) 20 220
ILL-LIB1 (10μM) 2 22
ILL-LIB2 (10μM) 2 22
5x Q5 Reaction Buffer 20 220
Q5 DNA Polymerase 1 11
TOTAL 100 550

 

Combined the following for PCR reactions:

  • 50μL PCR master mix
  • 40μL ligation mix
  • 5μL of ILL-HT1 (1μM)
  • 5μL of ILL-BC# (1μM) – The barcode number and the respective sample are listed below.

NOTE: Samples 02, 03, & 04 did not have 40μL of the ligation reaction left (only 32μL) due to additional usage in the test scale PCR yesterday. Supplemented those three reactions with 8μL of H2O to bring them to 100μL.

 

SAMPLE BARCODE SEQUENCE
Oly RAD 02  1  CGTGAT
Oly RAD 03  2  ACATCG
Oly RAD 04  3  GCCTAA
Oly RAD 06  4  TGGTCA
Oly RAD 07  5  CACTGT
Oly RAD 08  6  ATTGGC
Oly RAD 14  7  GATCTG
Oly RAD 17  8  TCAAGT
Oly RAD 23  9  CTGATC
Oly RAD 30 10 AAGCTA

 

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
12 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

 

After cycling, added 16μL of 6x loading dye to each sample.

Due to limitations in available comb sizes and inability to combine combs to make larger well sizes, only loaded 58μL of samples in each well on this gel. Will load remainder on a second gel and combine after PCR products are purified.

Results:

 

Well, this is lame. There are absolutely no PCR products on this gel. In fact, this just looks like big smears of degraded DNA. I was expecting an amplicon of ~166bp to cut out of the gel. Based off of the test scale PCR from yesterday, everything should have been hunky dory. Not really sure what to think about this…

Share

PCR – Oly RAD-seq Test-scale PCR

Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.

Prior to generating full-blown libraries, we needed to run a “test-scale” PCR to identify the minimum number of cycles needed to produce the intended product size (166bp).

I ran PCR reactions on a subset (Sample #: 2, 3, & 4) of the 10 samples that I performed adaptor ligations on Friday.

PCR reactions were set up on ice in 0.5mL PCR tubes.

REAGENT SINGLE REACTION (μL) x4.4
Template 8 NA
NanoPure H2O 1 4.4
dNTPs (1mM) 4 17.6
ILL-LIB1 (10μM) 0.4 1.76
ILL-LIB2 (10μM) 0.4 1.76
ILL-HT1 (1μM) 1 4.4
ILL-BC1 (1μM) 1 4.4
5x Q5 Reaction Buffer 4 17.6
Q5 DNA Polymerase 0.2 0.88
TOTAL 20 52.8

 

Combined 12μL of master mix with 8μL of the ligation reaction from earlier today.

Cycling was performed on a PTC-200 (MJ Research) with a heated lid:

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 98
  • 30
27 cycles
  • 98
  • 60
  • 72
  • 5
  • 20
  • 10

We’re following the “1/4 reduced representation” aspect of the protocol. As such, 5μL of each reaction was pulled immediately after the extension (72C – machine was paused) of cycles 12, 17, 22, & 27 in order to determine the ideal number of cycles to use. Also ran the ligation reactions (labeled “Ligations” on the gel below) of the samples as a pre-PCR comparison. Treated them the same as the PCR reactions: mixed 8μL of the ligation with 12μL of H2O, used 5μL of that mix to load on gel.

These samples were run on a 1x modified TAE 2% agarose gel (w/EtBr).

 

Results:

 

 

Test-scale PCR gel. Green arrow indicates desired band. The numbers below the headings indicate the sample number.

 

 

This looks pretty good. The green arrow on the gel indicates the desired band size (~166bp). Although difficult to see on this gel image, there is a gradient in band intensities across the cycles (band intensity increases as cycle number increases). Looks like we can use 12 cycles for our PCRs.

One other aspect of this gel that is very interesting is the ligations. The three ligation samples all show an intact high molecular weight band! This is very surprising, since the input gDNA from these three samples does not look this.

Share

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

Share