Tag Archives: sanger

Passing Flanks

A first look at population differences at qPCR primer sites for three population of Olympia oysters


Plate 1 (samwhite_112381) included, BMP2, CARM, HSPb11, and PGEEP4. At the bottom is a full list of qPCR primers.

BMP2

Limited coverage

CARM

Better coverage

conflicts were ambigs (ie S,W,R)

HSPb11

Missed qPCR primer (R did not seem to work)

PGEEP4

Nothing assembled – everything under 100 bp.


Plate 2 (samwhite_112404) included, H2A, H2AV, p291N, CRAF, GABABR, GRB2, H3-3

H2A

comp23253_c0_seq1
One primer not covered

H2AV

comp25000_c0_seq1
Not much coverage

p291N

comp22144_c0_seq1
Not much coverage

CRAF

comp25313_c0_seq1
Decent coverage, only conflict = ambig, SNP!

SNP

GABABR

comp19002_c0_seq1
Great coverage, did find some SNPs. Missed qPCR primer

SNPs

GRB2

comp10127_c0_seq1
Not great coverage

H3-3

comp19571_c0_seq1


List of QPCR Primers

QPCR Primer sequence Protein
HSP70c_FWD AGGAAAGGTCGGGAGAGGAA Heat shock 70 kDa protein 12A
HSP70c_REV ACCTCGGACTTTGGACGAAC Heat shock 70 kDa protein 12A
p29ING4_FWD TACCTTTGGGCTTCACCGTC Inhibitor of growth protein 4 (p29ING4)
p29ING4_REV GTCCATCACACACCCCTCAG Inhibitor of growth protein 4 (p29ING4)
CerS2_FWD TTGTCGGTCTCCTCCTGCTA Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
CerS2_REV CCGTCTTCTGAGCCATCGTT Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
GABABR1_FWD CCGAGGAGGACACGAAACTC Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
GABABR1_REV CGGACAGGTTCTGGATTCCG Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
HSP70d_FWD TTTGTCTCACCGGCTTTGTG Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B’)
HSP70d_REV GACATGAGACCAAAGACGCC Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B’)
THRa_FWD GACACTATCCTCACTCGGCG Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
THRa_REV GGGTGCCGAGTAAACAAGGA Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
Defensin_FWD TCTAGCGGAGTTTGTTGGGG Big defensin
Defensin_REV ATGGCTGTCGGAGGAGGATT Big defensin
GRB2_FWD AACTTTGTCCACCCAGACGG Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
GRB2_REV CCAGTTGCAGTCCACTTCCT Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
H3.3_FWD CACGCTCTCCTCGAATCCTC Histone H3.3
H3.3_REV AAGTTGCCTTTCCAGCGTCT Histone H3.3
H2A.V_FWD TGCTTTCTGTGTGCCCTTCT Histone H2A.V (H2A.F/Z) (Fragment)
H2A.V_REV TATCACACCCCGTCACTTGC Histone H2A.V (H2A.F/Z) (Fragment)
H2A_FWD GCTGGGGTTTTTCTGGGTCT Histone H2A
H2A_REV GGAACTACGCCGAGAGAGTG Histone H2A
Hspb11_FWD ATGTTTCCTGGTCTCCGTCA Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
Hspb11_REV CATCAACGCCAGGGGAACTT Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
GDF-8_FWD CCGTGGATGTCGCAGAAAGA Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
GDF-8_REV CTGCTTTCTCCGTCCCCTTT Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
HSP70b_FWD AAGTACCTTGGGGAGCTTGC Heat shock 70 kDa protein 12B
HSP70b_REV TCCACAGACTTTCCTCCCCA Heat shock 70 kDa protein 12B
GRP-78_FWD GAGAAACCACGCAGGGAGAA 78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
GRP-78_REV CATCAGCATCGAAGGCAACG 78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
CARM1_FWD TGGTTATCAACAGCCCCGAC Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
CARM1_REV GTTGTTGACCCCAGGAGGAG Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
BMP-2_FWD TGAAGGAACGACCAAAGCCA Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
BMP-2_REV TCCGGTTGAAGAACCTCGTG Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
PGE/EP4_FWD ACAGCGACGGACGATTTTCT Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
PGE/EP4_REV ATGGCAGACGTTACCCAACA Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
CRAF1_FWD AGCAGGGCATCAAACTCTCC TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
CRAF1_REV ACAAGTCGCACTGGCTACAA TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
NFKBina_FWD GATGGCGGTGCATGTGTTAG NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
NFKBina_REV CGAGGAGAACCTTGTGCAGT NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
PGRP-S_FWD GAGACTTCACCTCGCACCAA Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
PGRP-S_REV AACTGGTTTGCCCGACATCA Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
TLR2.1_FWD ACAAAGATTCCACCCGGCAA Toll-like receptor 2 type-1
TLR2.1_REV ACACCAACGACAGGAAGTGG Toll-like receptor 2 type-1
GDF-8b_FWD AACTGATTCTGCTCGTCGCA Growth/differentiation factor 8 (GDF-8) (Myostatin)
GDF-8b_REV TGTTCTTCCACCCACCACTG Growth/differentiation factor 8 (GDF-8) (Myostatin)
Share