Tag Archives: withering syndrome

Sample Prep – Withering Syndrome p18RK7 Plasmid Standard Curve Dilution

We are virtually out of the withering syndrome qPCR standard curve plasmid dilutions and I need to send some to Colleen Burge at Univ. of Maryland Baltimore County. As such, I’ll need to make a fresh dilution series and test it out prior to sending to her.

Used NcoI-linearized p18RK7 abalone withering syndrome plasmid (from 20120726) to make a fresh dilution series.

Since it’s been nearly 4yrs since the plasmid was prepared, I decided to re-quantify the DNA using a Qubit3 (Life Technologies) in the Roberts Lab. Used the dsDNA BR Qubit reagents.

SAMPLE CONCENTRATION (ng/μL)
p18RK7 NcoI-linearized 29.0

The result is pretty close to what had been measured 4yrs ago (~26.1ng/μL – difference of  ~10%), so that’s good to see.

I prepared the dilution series using IDTE (pH=8.0; IDT) Buffer. The dilution worksheet below was set up by Nate Wight many, many, moons ago.

Dilution calcs (Google Sheet): 20160316 – WS p18RK7 plasmid dilution table

Share

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

Share

Primer-BLAST – Withering Syndrome Phage Primers for qPCR & ISH

After designing new primers for use in Withering Syndrome phage (RLOv) identification on 20150706, ran Primer-BLAST via NCBI’s website to assess primer specificity. Ran Primer-BLAST with each primer set against the NCBI nr Viruses (Tax ID:10239 ) and Prokaryotes (Tax ID: 2) nucleotide databases. Excluded uncultured/environmental samples from the databases. The general setting for the Primer-BLASTs can be seen in the screen capture below. Entered in each primer set in the “Primer Parameters” boxes.

The Primer-BLAST only exhibits an output if either of the primers produce a match. When primers do have a match in the database, an alignment of primer(s) is shown on the matching template. Dots in the alignment are exact nucleotide matches, whereas mismatched nucleotides are simply displayed with their corresponding letter in the alignment.

Results:

qPCR Primers

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG


ISH Primers

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

This shows some matching to a single template and only with the forward primer. It should be fine to use for ISH.

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

The forward primer and the reverse primer show some matching, but those matches exist in two different species. As such, these primers should be fine for use in ISH.

Share

Primer Design – Withering Syndrome Phage for qPCR & ISH

Stan Langevin recently annotated the Withering Syndrome (WS) bacteriophage genome he previously assembled. Additionally, after discussing with Carolyn, they decided on two new potential qPCR targets and three potential in-situ hybridization (ISH) targets. Stan provided a FASTA file with the five sequences and primers were designed using Primer3Plus.

For qPCR primers, amplicon length range was set to 150-250bp. Additionally, I had Primer3Plus design an internal primer for potential future use as a fluorescent probe, should we ever establish one of these qPCRs as a validated WS phage assay.

The ISH primers amplicon length range was set to 400-500bp.

All primers (excluding probes) will be ordered from IDT.


qPCR

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA
Probe: TGCGCATGCTATCCATGGAAACA

 

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG
Probe: GCCTGTGATCTCAAACAACGCTGC


 

ISH

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

 

 

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

Share

qPCR – 2011 Ab Endo Water Filters

Ran qPCRs on remaining 2011 water filter DNA samples. All samples were from The Cultured Abalone farm, but some samples are abbreviated “CAB”, while others “TCA”. Samples were extracted 20131001 and 20131120.

Master mix calcs: 20150702 – qPCR WS Ab Endo H2O Filters

All samples were run in duplicate. See qPCR Report in Results below for cycling params.

Standard curve was p18RK7 from 20120731.

Baseline threshold was set to 580, as determined by Lisa.

Results:
qPCR Report (PDF): Sam_2015-07-02 09-45-05_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-07-02 09-45-05_CC009827.pcrd

Data entered in the Ab Endo Samples Google Sheet.

Share

qPCR – 2011 Ab Endo Water Filters

Master mix calcs are here: 20150622 – qPCR WS Ab Endo H2O Filters

All samples were run in duplicate. See the qPCR Report (in Results below) for plate layout, cycling params, etc.

Standard curve was p18RK7 from 20120731.

Baseline threshold set to 580, based on calculations by Lisa.

Results:

qPCR Report (PDF): Sam_2015-06-22 14-25-45_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-06-22 14-25-45_CC009827.pcrd

All data was entered in to the Ab Endo Samples spreadsheet.

Share

Samples for Abalone Withering Syndrome ddPCR

I selected the following samples (Ab Endo 2011 Water Filter DNA samples) to send to Alice Nguyen at the Marine Science Institute for digital droplet PCR (ddPCR):

  1. CI SRI CP 1A (0 copies)
  2. CI SRI CP 2B (highest)
  3. CI SRI CP 2A (0 copies)
  4. CI SRI CP 1B (high)
  5. CARMEL +500M 1 (medium)
  6. CARMEL +500M 2 (low)

10μL of each sample was sent. Tubes were labelled with “DNA #”. The ‘#’ corresponds to the number in the list above.

10μL of each of p18RK7 qPCR standards (from 20120730) were sent.

Two sets of WSN1 F/R working stocks (10μM) were also sent.

Also sent the QX200 Droplet Generation Oil for EvaGreen Kit (BioRad) that we ordered.

Shipment was on “wet” ice.

Share

qPCR – Withering Syndrome ddPCR Comparison Repeat

Repeated the qPCR from yesterday due to inconsistent results when compared to the previous qPCR data (see table in yesterday’s notebook entry), but used the stock DNA for template.

These samples were initially quantified as part of the Ab Endo Project (Ab Endo 2011 Water Filter DNA samples). Here’s the list of samples:

  1. CI SRI CP 1A
  2. CARMEL +500M 2
  3. CI SRI CP 2B
  4. CI SRI CP 2A
  5. CI SRI CP 1B
  6. CARMEL +500M 1

Master mix calcs are here: 20150415 – qPCR WS Ab Endo vs ddPCR

Standard curve was p18RK7 (from 20120730).

Cycling params, plate layout, etc. can be found in the qPCR Report (see Results below).

Results:
qPCR Report (PDF): Sam_2015-04-16 12-14-37_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-04-16 12-14-37_CC009827.pcrd

TABLE – Summary of qPCRs and ddPCR data

Sample Number Sample Name Initial qPCR Copies ddPCR Copies Yesterday’s qPCR Copies Today’s qPCR Copies
AB01 CI SRI CP 1A 0 3.8 0 0
AB02 CARMEL +500M 2 1.57 8.7 1.3 1.05
AB03 CI SRI CP 2B 147 104 59.2 201
AB04 CI SRI CP 2A 0 175 83.1 0.68
AB05 CI SRI CP 1B 74.8 2.8 0 101
AB06 CARMEL +500M 1 1.08 4.9 0 0.37

Today’s qPCR data matches up very well with the initial qPCR data.

Clearly, there is something odd about the aliquots that were sent to Alice (and back) for use in ddPCR. I can’t really fathom what happened. Will contact Alice and see if she’d like to try out new aliquots of these samples to see how the ddPCR turns out (again).

Share

qPCR – Withering Syndrome ddPCR Comparison

Performed qPCR on the same exact samples previously sent to Alice Nguyen at the Marine Science Institute for digital droplet PCR (ddPCR) to compare our results to hers. These samples were previously quantified as part of the Ab Endo Project (Ab Endo 2011 Water Filter DNA samples). Here’s the list of samples that were sent to (and back from) Alice:

  1. CI SRI CP 1A
  2. CARMEL +500M 2
  3. CI SRI CP 2B
  4. CI SRI CP 2A
  5. CI SRI CP 1B
  6. CARMEL +500M 1

Master mix calcs are here: 20150415 – qPCR WS Ab Endo vs ddPCR

Standard curve was p16RK7 (from 20120730).

Cycling params, plate layout, etc. can be found in the qPCR Report (see Results below).

Results:
qPCR Report (PDF): Sam_2015-04-15 15-38-13_CC009827.pdf
qPCR Data File (CFX96): Sam_2015-04-15 15-38-13_CC009827.pcrd

Table – Summary of qPCRs and ddPCR data

Sample Number Sample Name Initial qPCR Copies ddPCR Copies Today qPCR Copies
AB01 CI SRI CP 1A 0  3.8  0
AB02 CARMEL +500M 2 1.57  8.7  1.3
AB03 CI SRI CP 2B 147  104  59.2
AB04 CI SRI CP 2A 0  175  83.1
AB05 CI SRI CP 1B 74.8  2.8  0
AB06 CARMEL +500M 1 1.08  4.9  0

The table certainly shows some inconsistency, both between ddPCR and qPCR. Additionally, there is also inconsistency between the initial qPCRs and today’s qPCRs. Due to the limited sample volumes remaining for these sub-samples that were sent to Alice and then returned to us, I will repeat the qPCR using the stock DNA and see how that compares.

Share