The Little Things

Posted by & filed under Miscellaneous.

Getting back into gear, I am assisting Andrew ID some targets from a salmonid transcriptome. With said transcriptome I am taking the blast output and getting some protein names sans SQLshare. The tldr can be seen here, but if you have the time I will point out the key code aspects and leave you with… Read more »

From Ensenada and beyond

Posted by & filed under Panopea generosa.

There have not been many posts recently, but that is not to say I have not been doing any science. Much of what I have been doing is numerous burst commits on the Panopea transcriptome paper / project. This can be found @ https://github.com/sr320/paper-pano-go. You can see all the Jupyter nbs in this sub-directory. I… Read more »

Sifting Sands

Posted by & filed under Miscellaneous, Workflows.

Below is a quick workflow I am using to help Drinan annotate ~1.5 million sequences from an amplicon targeting NGS effort of sand. head /Users/sr320/Dropbox/hummingbird-ipython-nbs/data/DanD/meiofauna_forward_sequences.fa >M02215:33:000000000-AFA9E:1:1101:14961:2005 1:N:0:15 TGACTGTGCTAAGGTAGCATAATTAATTGTCTTTTAATTAGAGACTTGTTTGAAAGATTT TTTGAATTTAATATAGTTTTAAAATTATAAAAATGAATTTTTATATATTGGTAAAAATAC CATGATTTTTTAAAAAGACGATAAGACCCTATCAAGTTTTACTTAAATTTAAAGAAAATT TAGGTTTTAATGGGGCATTATTATTTATTTTAAATAAATTTTGATCTTAAATTAAATTTT AGGAAATTTAATAAAATTACTGTAGGGATAACAGTGTAATATTTTTTAAAGTTCATATTT A >M02215:33:000000000-AFA9E:1:1101:11050:2011 1:N:0:15 TAACTGTGCTAAGGTAGCATAATCACTTGTCTCCTAATTAGAGACTGGCATGAAAGGGTA AACTCTTTATAACTTTATAAAGCATACACACTGAAATTTTTATTTAGACGAAGAAATCTA       Within a given working directory I proceeded to (in Jupyter NB) cp meiofauna_forward_sequences.fa query.fasta –… Read more »

A short sequence on short sequence

Posted by & filed under Tutorial.

A quick tutorial to check out primers on NCBI to see what the product size should be and how specific they are. Old school way is just take the primer with NNNs in the middle and blast. TATTCGTTGGAGACTTTATAACCCTNNNNNNNNNNNNNNNNNNNNNAAGGCTTAGAATTGCAAGGTCTATA You will get an output as such…. Scroll down to the alignments…. And look at the coordinates……. Read more »

Developing CpG O/E Workflow

Posted by & filed under Workflows.

In an effort to streamline CpG O/E determination across various transcriptomes, here is my latest attempt. tldr; Ahyacinthus = This is dependent on have GO slim annotations for all genes – for this particular case the annotation pipeline can be seen here.