PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1╬╝Var specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

One thought on “PCR – OsHV-1 ORF117 from Australian, California, & French Variants

  1. Pingback: Cloning – Purified OsHV-1 ORF117 PCRs | Sam's Notebook

Leave a Reply

Your email address will not be published. Required fields are marked *


e.g. 0000-0002-7299-680X

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>