Cloning – Purified Abalone RLOv PCR Products

Purified PCR products from 20151008 (in situ hybridization [ISH] primers) & 20151009 (qPCR primers) RLOv primers were used for cloning. The qPCR primers are intended to develop a qPCR standard curve and the ISH primers are intended to develop three ISH probes.

  • RLOv_DNA_helicase (for qPCR)
  • RLOv_head_to_tail_gene (for qPCR)
  • RLOv_membrane_gene_1 (for ISH)
  • RLOv_membrane_gene_2 (for ISH)
  • RLOv_tail_fiber_gene (for ISH)

The PCR products were separately ligated using The Original TA Cloning Kit (Invitrogen).

LIGATIONS

REAGENT SINGLE REACTION VOL (μL) x 5.5
Purified PCR 5 NA
10x Ligase Buffer 1 5.5
pCR2.1 Vector 2 5.5
H2O 1 5.5
T4 DNA Ligase 1 5.5
TOTAL 10 22

Ligation reactions were set up on ice.Combined 5μL of purified PCR product with 5μL of ligation master mix in a 1.5mL snap cap tube. Incubated 24hrs @ RT.

 

TRANSFORMATIONS

50μL of X-gal (20mg/mL) was added to a LB-Amp100 plates, spread and warmed @ 37C.

Five vials of OneShot TOP 10 chemically competent cells (Invitrogen) were thawed on ice. 3μL of the ligation reaction was added to the cells, gently mixed and incubated on ice for 5mins. 50μL of cells were transferred to the LB-Amp100+X-gal plates, spread and incubated O/N at 37C.

Agarose Gel – Phage ISH Primers PCRs

Ran PCR products from yesterday on a 1% agarose 1x TBE gel, stained with ethidium bromide.

Results:

IMPORTANT NOTE: The negative control sample should actually be labelled UW08:22-11A.

 

PRIMER SET EXPECTED PCR SIZE (bp) RESULT SIZE (bp)
RLOv_membrane_gene_1 401 ~400bp
RLOv_membrane_gene_2 318 ~400bp
RLOv_tail_fiber_gene 451 ~500bp

PCR looks great. Excellent amplification in the RLO positive samples (06:6-54), with no amplification in the negative controls (UW08:22-11A) nor in the no template controls (NTC).

Excised the bands from each of the RLOv positive samples (see gel image below) and purified the DNA using UltrafreeDA Spin Columns (Millipore) according to the manufacturer’s protocol. DNA was stored @ 4C for cloning/labelling/sequencing at a later date.

Gel image showing excised regions.

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

Primer-BLAST – Withering Syndrome Phage Primers for qPCR & ISH

After designing new primers for use in Withering Syndrome phage (RLOv) identification on 20150706, ran Primer-BLAST via NCBI’s website to assess primer specificity. Ran Primer-BLAST with each primer set against the NCBI nr Viruses (Tax ID:10239 ) and Prokaryotes (Tax ID: 2) nucleotide databases. Excluded uncultured/environmental samples from the databases. The general setting for the Primer-BLASTs can be seen in the screen capture below. Entered in each primer set in the “Primer Parameters” boxes.

The Primer-BLAST only exhibits an output if either of the primers produce a match. When primers do have a match in the database, an alignment of primer(s) is shown on the matching template. Dots in the alignment are exact nucleotide matches, whereas mismatched nucleotides are simply displayed with their corresponding letter in the alignment.

Results:

qPCR Primers

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG


ISH Primers

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

This shows some matching to a single template and only with the forward primer. It should be fine to use for ISH.

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

The forward primer and the reverse primer show some matching, but those matches exist in two different species. As such, these primers should be fine for use in ISH.

Primer Design – Withering Syndrome Phage for qPCR & ISH

Stan Langevin recently annotated the Withering Syndrome (WS) bacteriophage genome he previously assembled. Additionally, after discussing with Carolyn, they decided on two new potential qPCR targets and three potential in-situ hybridization (ISH) targets. Stan provided a FASTA file with the five sequences and primers were designed using Primer3Plus.

For qPCR primers, amplicon length range was set to 150-250bp. Additionally, I had Primer3Plus design an internal primer for potential future use as a fluorescent probe, should we ever establish one of these qPCRs as a validated WS phage assay.

The ISH primers amplicon length range was set to 400-500bp.

All primers (excluding probes) will be ordered from IDT.


qPCR

Black_abalone_RLOv_DNA_helicase_gene

Left: AATGGGAAAGACAGCCCTGG
Right: TACGATGGGCAGTGAGGAGA
Probe: TGCGCATGCTATCCATGGAAACA

 

Black_abalone_RLOv_head-to-tail_connection_gene

Left: GAACAACGTGGGGAGACTGT
Right: AGCCAACCCCGTAGTCAATG
Probe: GCCTGTGATCTCAAACAACGCTGC


 

ISH

Black_abalone_RLOv_tail_fiber_gene

Left: CAACAGATGCACAAACGGCA
Right: GCTTCTCCAACAGGGGCTAG

 

Black_abalone_RLOv_membrane_gene_(1)

Left: TCCAGTTCTCCTACTAGCGCT
Right: GCTCTACTAAAACAACTCCCAGC

 

 

Black_abalone_RLOv_membrane_gene_(2)

Left: TGCCAATAGTTGCAGTTGGTG
Right: CCCCTTGAGCAAAATCCCCA

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 3

Slides were briefly rinsed in dH2O three times.

Slides were counter stained with 0.05% aqueous Bismark Brown Y for 3mins @ RT.

Slides were briefly rinsed in dH2O, then 70% EtOH, then 100% EtOH.

Slides were air-dried in the fume hood.

Coverslips were added to each slide with three drops of Permount.

Permount was allowed to dry O/N at RT.

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 2

Stringency Washes

Hybridization solution was discarded and slides rinsed for ~30mins in 2x SSC.

Cover slips were removed.

Slides were washed twice in 2x SSC 15mins @ 40C.

Slides were washed three times in 1x SSC 15mins @ 40C.

Slides were washed once in 0.5x SSC 15mins @ 40C.

Tissue was equilibrated in Buffer 1 (100mM Tris-HCl, 10mM NaCl, pH = 7.5) 10mins @ RT.

Tissues were blocked with Blocking Buffer (Buffer 1 + 2% sheep serum + 0.3% Triton-X 100) for 1hr @ RT (500uL on each slide).

Detection

Antibody solution – Diluted alkaline phosphatase-labelled sheep anti-DIG 1:1000 in Blocking Buffer.

Added 1mL of antibody solution to each slide and incubated without a cover slip for 2hrs @ RT.

Rinsed slides with Buffer 1 for 10mins, two times.

Rinsed slides with Buffer 2 (100mM tris-HCl, 100mM NaCl, 50mM MgCl2; pH = 9.5) for 10mins.

Incubated slides in substrate solution (10mL Buffer 2 + 45uL NBT [nitroblue tetrazolium] + 25uL BCIP) O/N @ RT.

In-situ Hybridization (ISH) – Abalone Withering Syndrome and Phage ORF25: Day 1

Selected three unstained abalone post-esophagus sections from samples positive for the phage (08:36-17B 2-4) and three unstained sections negative for phage (08:13-5A 7-9).

All slides were processed in a single, vertical glass slide incubator, unless noted.

All slides were deparaffinized with three changes of xylene (SafeClear II; Fisher) for 10mins each.

Slides were hydrated with a graded ethanol series (100%, 100%, 80%, 70%, 50%) for 3mins each.

Slides were rinsed with molecular grade H2O.

Tissue sections were equilibrated in Tris Buffer (0.2M Tris-HCl, 2.0mM CaCl, pH = 7.2) for 5mins.

Tissues were permeabilized for 1.5hrs in preheated 50ug/mL Proteinase K (Qiagen) in Tris Buffer @ 56C.

Slides were rinsed with 1x PBS three times, 10mins each.

Slides were incubated 30mins in Prehybridization Buffer (50% deionized formamide, 4x SSC) @ 53C.

Prepared probes (from 20141008) by boiling 3mins and immediately incubating in ice water bath for 30mins.

Slides were rinsed with 2x SSC and air dried for 5mins.

Probes were diluted 1:300 in 600uL of Prehybridization Buffer. Both negative control probes were combined into a single dilution.

300uL of probe solutions and cover slip were added to the following slides:

  • Phage ORF25: 08:36-17B 2, 08:13-5A 7

  • WSN1: 08:36-17B 3, 08:13-5A 8

  • Negative Controls: 08:36-17B 4, 08:13-5A 9

The three groups of slides were placed into separate slide cases and a 1mL of Prehybridization Buffer was added to each case (to maintain high humidity during incubation).

The cases were incubated on their sides O/N @ 53C.

Restriction Digestion – Withering Syndrome Phage ORF25 Plasmid from 20140926

Performed restriction digest using NcoI (NEB) to linearize plasmid for use as qPCR standard curve. Reactions were run for 1hr @ 37C and then heat inactivated @ 65C for 20mins.

Each reaction contained:

pCR2.1/Phage ORF25 (~1ug) – 17uL

10x Buffer 3 – 5uL

NcoI – 1uL

H2O – 27uL

Total: 50uL

After inactivation, 5uL from the reaction was run on a 1% TBE gel to confirm digestion. 5uL of undigested plasmid was run along side the digest.

Results:

Gel Loading Guide:

Lane 1 – Hyperladder I (Bioline)

Lane 2 – pCR2.1/ORF25 (undigested)

Lane 3 – pCR2.1/ORF25 (NcoI)

Vector size (bp): 3929

Insert size (bp): 483

Total size (bp): 4412

The linearized plasmid (which contains a single NcoI recognition site) runs between the 5000 and 4000bp standards, which is what we expect. Will quantify and generate dilution series for use as a qPCR standard curve.

PCR – In-situ Hybridization (ISH) Probe

Ran probe-labeling PCRs to use in in-situ hybridization (ISH). Generated PCR probes for the following:

Phage ORF20

Phage ORF25

Withering Syndrome (p18RK7, 3e6)

PCR calculations are here: 20141008 – ISH Probe PCRs

Used the PCR DIG Probe Synthesis Kit (Roche), with 10pg of template for each probe. Ran a DIG positive and DIG negative sample for each sample.

Cycling Params:

  1. 95C – 5mins

  2. 95C – 15s

  3. 55C – 15s

  4. 72C – 30s

  5. Go to Step 2, repeat 39 times.

  6. 72C – 10mins

Ran 5uL of each sample on a 1% agarose 1x TBE gel, stained with EtBr.

Results:

Ladder: Hyperladder I (Bioline)

ORF25 and p18RK7 PCRs seemed to have worked as expected. This is evidenced by larger molecular weight bands in the DIG-positive samples (the DIG molecules incorporated during PCR result in slower migration through the gel).

However, the ORF20 PCR doesn’t seemed to have worked in either the DIG-postiive nor the DIG-negative. I won’t bother re-running this, since the ORF25 will also function as a probe for detection of withering syndrome phage.

Probes were stored @ -20C in my -20C box.