qPCR – Pinto Abalone DNA with WSN1 and RLOv DNA Helicase

Ran qPCRs using both WSN1 and RLOv DNA Helicase primers on the pinto abalone DNA isolated earlier today, as well as one additional sample that Sean Bennett had previously isolated DNA from: 15:6-26E

RLOv helicase standard curve is from 20151106.

WSN1 standard curve is p18RK7 from 20170703

All samples were run in duplicate.

Master mix calcs (Google Sheet): 20171226 – qPCR Pinto WSN1 & RLOv DNA Helicase.

Plate layout, cycling params, etc. can be seen in the qPCR Reports (see Results below).

Results:

RLOv helicase qPCR Report (PDF): Sam_2017-12-26 13-19-51_CC009827_RLOv_helicase.pdf
RLOv helicase qPCR File (CFX): Sam_2017-12-26 13-19-51_CC009827_RLOv_helicase.pcrd

WSN1 qPCR Report (PDF): Sam_2017-12-26 13-19-51_CC009827_WSN1.pdf
WSN1 qPCR File (CFX): Sam_2017-12-26 13-19-51_CC009827_WSN1.pcrd

Both standard curves are acceptable (see images below).

No amplification with either primer/probe set in the following samples:

  • 15:30-01
  • 15:30-04

I believe these are both “Control” samples (i.e. unexposed) and no amplification was expected.

All other samples amplify. See qPCR Reports for copy numbers.

RLOv Helicase Amplification & Standard Curves

WSN1 Amplification & Standard Curves

Cloning – Purified OsHV-1 ORF117 PCRs

Purified OsHV-1 ORF117 PCRs from earlier today were separately ligated using the Original TA Cloning Kit (Invitrogen).

LIGATION

Ligation reactions:

  • PCR product: 5μL
  • 5x Buffer: 2μL
  • Vector (pCR2.1): 2μL
  • T4 Ligase: 1μL

Incubate 1hr @ RT.

TRANSFORMATION

50μL of X-gal (40mg/mL) was added to a LB-Amp100 plate, spread and warmed @ 37C.

Three vials of OneShot TOP 10 chemically competent cells (Invitrogen) were thawed on ice. 5μL of the ligation reaction was added to the cells, gently mixed and incubated on ice for 5mins. Thecells were transferred to the LB-Amp100+X-gal plates, spread and incubated O/N at 37C.

Results:

All three transformations failed. All of them produced only blue colonies and very few total colonies.

The low number of colonies prompted me to look at the troubleshooting in the manual for The Original TA Cloning Kit (Invitrogen). It turns out that after six months of storage, the vector begins to lose the T overhangs. The kit I used is from 2014; three years beyond the tentative expiration date. This is likely the cause of the failed transformations.

DNA Isolation & Quantification – Pinto Abalone

Isolated DNA from the following pinto abalone (Haliotis kamtschatkana) digestive gland tissues (stored in ethanol), collected by Sean Bennett as part of his Capstone project:

Accession Weight(mg)
15:30-01   194
15:30-04   67
15:31-01   34
15:31-02   107
15:31-03   83
15:31-04   80

Tissue was weighed and then DNA extracted.

DNA was extracted using the QIAmp Fast DNA Stool Mini Kit (Qiagen) following the manufacturer’s protocol with the following options:

  • Samples were briefly homogenized (due to their stiffness resulting from ethanol fixation) in the InhibitEX Buffer using disposable plastic pestles.
  • Homogenized tissue was incubated at 95C to maximize cell lysis
  • Followed “human DNA analysis” protocol for remainder of protocol (to maximize sample recovery)
  • Eluted DNA with 100μL Buffer ATE

Used the Roberts Lab Qubit 3.0 and the Qubit hsDNA Kit (high sensitivity). Used 1uL of template for all samples.

Samples were stored at -20C in FSH240 in the “Pinto Transcriptome DNA” box.

Results:

All samples have DNA.

Concentrations (Google Sheet): 20171226_qubit_DNA_pinto_ab

PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

qPCR – Test Australian OsHV-1 ORF117 Primers

Using primers I previously designed, I tested them out for functionality (using the clone #1 plasmid prep DNA I made previously) and specificity (using the Australian, California, & French variants recently received)

Created a working 1:100 dilution of ALL DNA tested here.

All samples were run in duplicate.

Master mix calcs are here (Google Sheet): 20171221 – qPCR Austrailian OsHV-1 ORF117 Primer Test

Cycling params, plate layout, etc. can be viewed in the qPCR Report (see Results below).

Results:
qPCR Report (PDF): Sam_2017-12-21 15-09-49_CC009827.pdf
qPCR Data File (CFX): Sam_2017-12-21 15-09-49_CC009827.pcrd

Firstly, the primers work and generate a single melt curve peak (see melt curve plot below); so that proves functionality.

Results are interesting.

Australian samples (plasmid and DNA) amplify.

French samples (M1 & M2) do not amplify.

California samples: 3 of 4 samples amplify.

It’s possible that the California sample that did not amplify is due to too little DNA present in the 1:100 dilution I used (or, possibly no DNA is present at all). I have not quantified the DNA in these samples – went off assumption that the samples had previously been confirmed to have DNA in them by the source laboratories.

Regardless, the primers used here will amplify the French variant, but will amplify Australian and Californian variants.

See labeled amplification plots below.

Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

The last run at this failed, but I think that was due to old ampicillin stocks; leading to no selective pressure for transformants that actually contained plasmid.

I’ve since remedied that.

Grew up 5mL of culture from the only two transformants in 1xLB + 100ug/mL of (fresh!) ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 3mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 10uL of sample.

Results:

Quantification (Google Sheet): 20170817_quantification_oshv_orf117_plasmid

Colony 1 – 130ng/uL
Colony 2 – 148ng/uL

Yields look perfect. Will submit for sequencing at Genewiz (they need 10uL of ~50ng/uL DNA) and see what we have here…

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

Yesterday’s transformation with freshly prepared ampicillin didn’t produce any transformants, suggesting the DNA concentration is too low.

Previously, I tried to elute the DNA from one of the spots Tim sent with 50uL. This volume was enough to soak the Whatman paper and produce excess liquid. In retrospect, I think the volume was too large and diluted the DNA too much (concentration wasn’t measurable via Qubit)

Today, I eluted with 25uL. Since this volume was too little to produce excess liquid, I created a spin “filter” to extract the absorbed liquid. Briefly, I punctured the top and bottom of a 0.5mL snap cap tube with an 18 gauge needle, inserted the Whatman paper disc into this tube, and then put this tube in a 2mL snap cap tube. This assembly was spun @ 18,000g RT for 3 mins.

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

Wow, only two colonies! Well, as they say, you only need one. Will PCR, re-streak, and inoculate 5mL liquid cultures to see if either of these colonies seem to have the insert.

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

This is a repeat since the previous attempt at obtaining sufficient quantities of plasmid for sequencing failed. Although I’m not sure why, I figure it’s easy enough to re-do using ampicillin stocks that aren’t many years old. :)

The old ampicillin may not have been strong enough to put enough selective pressure on transformants, which possibly led to such little plasmid recovery.

I prepared fresh ampicillin solution (20mg/mL) and made new LB plates (ampicillin concentration 100ug/mL).

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol (thaw cells on ice, add DNA, incubate 5mins, plate on pre-warmed ampicillin plates).

Cells were plated on pre-warmed (37C) LB Amp100 plates.

Plates were incubated overnight at 37C.

Results:

No transformants. So, this suggests that the original ampicillin was bad. Now, the lack of transformants suggests the plasmid concentration is too low. Will try eluting the DNA from the second spot of Whatman paper.