Plasmid Isolation – pCR2.1/OsHv-1_ORF117 Miniprep

Grew up 5mL of culture from re-streaked colony #1 in 1xLB + 100ug/mL of ampicillin @ 37C on a rocking platform in a 15mL conical over night (~18hrs).

Isolated plasmid DNA from the entire 5mL of culture (repeated pelleting of bacteria in the same 1.5mL snap cap tube) using the QIAprep Spin Miniprep Kit, according to their protocol.

Eluted DNA with 50uL of EB Buffer.

Quantified on the Roberts Lab Qubit 3.0 using the dsDNA BR Kit (broad range) and 1uL of sample.

Results:

The results are not good. Using 1uL of the sample, I received an error message that the concentration was out of range – too low!

Repeated, but used 10uL of sample. Concentration was displayed as 1.13ng/uL!!

This is insufficient yield/concentration for sequencing.

It’s possible that the kit is too old (no receipt date marked on the box…)? The reagents shouldn’t go bad, but can the columns? I feel like the resins in the columns are pretty stable, just like the various buffers.

The ridiculously low yields could also possibly indicate that the bacteria don’t actually have the plasmid, but PCRs from yesterday suggest otherwise.

Maybe the column was overloaded? I’ll repeat this next week, but using smaller culture size and/or not using the column and perform an isopropanol precipitation instead…

And/or make fresh stock of ampicillin (current stock is many years old, but has been frozen).

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Transformation – pCR2.1/OsHV-1_ORF117 into One Shot Top10 Chemically Competent Cells

Used 5uL of the pCR2.1/OsHV-1_ORF117 plasmid provided by Tim Green to transform a single aliquot of One Shot Top10 Chemically Competent Cells (Invitrogen), according to the “Rapid Transformation” protocol.

Cells were plated on pre-warmed (37C) LB Amp100 plates with X-gal.

Plates were incubated overnight at 37C.

Results:

Looks good – ample colonies and no blue colonies (blue colonies = empty vector). Will screen a subset of the colonies via cPCR.

 

 

qPCR – Check New Withering Syndrome p18RK7 Plasmid Standard Curve Dilution

This is a qPCR to test the fresh p18RK7 dilution I made earlier today, and verify it works well (i.e. linear spread, good R^2 value, same Cqs as previous curve dilution, etc.).

Master mix calcs were re-used from previous standard curve check (Google Sheet): 20161128 – qPCR WS p18RK7 Curve Check

I made three separate master mixes to check the curve three times.

All samples were run in duplicate. Plate layout, cycling params, etc. are in the qPCR Report (see Results below).

Baseline threshold was manually set to 580, as previously determined by Lisa for this assay.

Results:

qPCR Report (PDF): Sam_2017-07-03 09-34-31_CC009827.pdf
qPCR Data File (CFX): Sam_2017-07-03 09-34-31_CC009827.pcrd

Curve looks good! Will use this one going forward. Will store in the withering syndrome standard curve box in the FSH 240 4C.

 

ALL MIXES

 

Sample Prep – Withering Syndrome p18RK7 Plasmid Standard Curve Dilution

The last dilution I made was jacked up, so I made a new one today.

Used the 3e7 dilution of p18RK7 from 20161128 as the “stock” to make serial, 1:10 dilutions (final volume of 1000uL in each tube).

I prepared the dilution series using lab-made Low TE Buffer (pH=8.0). The original dilution worksheet below was set up by Nate Wight many, many, moons ago.

Dilution calcs (Google Sheet): 20160316 – WS p18RK7 plasmid dilution table

Will test out the new curve dilution shortly.

qPCR – Check New Withering Syndrome p18RK7 Plasmid Standard Curve Dilution

This is a qPCR to test the fresh p18RK7 dilution I made earlier today, and verify it works well (i.e. linear spread, good R^2 value, same Cqs as previous curve dilution, etc.).

Master mix calcs were re-used from previous standard curve check (Google Sheet): 20161128 – qPCR WS p18RK7 Curve Check

I made three separate master mixes to check the curve three times.

All samples were run in duplicate. Plate layout, cycling params, etc. are in the qPCR Report (see Results below).

Baseline threshold was manually set to 580, as previously determined by Lisa for this assay.

Results:

qPCR Report (PDF): Sam_2017-06-29 12-49-46_CC009827.pdf
qPCR Data File (CFX): Sam_2017-06-29 12-49-46_CC009827.pcrd

 

I screwed something up in the dilution series. Seems difficult to screw up something so basic, but the results don’t lie. Will discard this curve and will remake the curve and re-test. Argh!

 

 

Sample Prep – Withering Syndrome p18RK7 Plasmid Standard Curve Dilution

The withering syndrome standard curve on my last two qPCRs has been wonky, so I’m making a new curve.

Used the 3e7 dilution of p18RK7 from 20161128 as the “stock” to make serial, 1:10 dilutions (final volume of 1000uL in each tube).

I prepared the dilution series using IDTE (pH=8.0; IDT) Buffer. The original dilution worksheet below was set up by Nate Wight many, many, moons ago.

Dilution calcs (Google Sheet): 20160316 – WS p18RK7 plasmid dilution table

Will test out the new curve dilution shortly.

DNA Quantification – RLO viability DNased RNA

I previously DNased RNA I isolated from water filters that were part of the RLO viability experiment that Lisa and the Capstone students are conducting. I checked for residual gDNA carryover via qPCR and all of the samples that were intended for dosing the abalone came up positive. It’s likely due to such a high quantity of algae that was co-filtered with the potential RLOs, leading to over-saturation of the RNAzol with DNA, resulting in the gDNA carryover.

In turn, I think the DNase treatment was insufficient for the quantity of carryover DNA.

I am planning on re-DNasing those samples, but want to quantify any residual DNA present to make sure that the samples aren’t still too concentrated for the DNase.

Samples were quantified using the Robert Lab Qubit 3.0 and the Qubit dsHS reagents (high sensitivity), using 1uL of sample.

Results:

Residual DNA is still present, but at levels that are well below the maximum that the DNase treatment (10ug) can handle. I will redo the DNase treatment on these samples. Spreadsheet is linked, and embedded below, with sample concentrations.

Spreadsheet (Google Sheet): 20170424_filter_rna_dna_quant

qPCR – CDFW White Abalone Samples (RLOv DNA helicase)

The samples that CDFW sent us earlier were previously checked for RLO presence with the withering syndrome qPCR assay.

Standard curve was from 20151106.

All samples were run in duplicate.

Master mix calcs are here; since I ran these with the other samples, the master mix used was part of the other project indicated in the spreadsheet (Google Sheet): 20170420 – qPCR RLOv DNA Helicase

Plate layout, cycling params, etc. can be found in the qPCR Report (see Results).

Baseline threshold was manually set to 580.5, as previously determined.

Results:

qPCR Report (PDF): Sam_2017-04-20 07-50-18_CC009827.pdf
qPCR Data File (CFX): Sam_2017-04-20 07-50-18_CC009827.pcrd

Standard curve looks good and all samples provided come up positive for RLOv DNA helicase.

I’ve compiled the raw data of both the WSN qPCR and this in this Google Sheet: 20170420_CDFW_White_Ab_qPCR_summary

Here’s a summary table of the results (copy numbers are mean copies from qPCR replicates):

SAMPLE RLOV DNA HELICASE (COPIES) WSN1 (COPIES)
SF16-76_DG-1  165318.58 169.25
 SF16-76_DG-2  47839.81  20.70
 SF16-76_PE-1  1036697.17 633.75
 SF16-76_PE-2  46763.60  296.83
 SF17-17  117.29  2.16

NOTE: The WSN1 copies for SF17-17 is below the accepted detection limit of the qPCR assay (i.e. < 3 copies).

Will share my notebooks and spreadsheet with Blythe at CDFW.

Amplification Plots

Green = Standard Curve

Blue = Samples

Red = No template control