PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

PCR – RLOv Clones

Colony PCRs were performed on each of the transformations from 20151015 (RLOv_ DNA_helicase, RLOv_head_to_tail, RLOv_membrane_gene_1, RLOv_membrane_gene_2, RLOv_tail_to_fiber) to confirm successful ligations in plasmid pCR2.1 using the M13F/R vector primers.

Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp100+x-gal plate and then used to inoculate the respective PCR reactions.

Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Master mix calcs are here (Google Sheet): 20151019 – Colony PCRs RLOv

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

 

All the PCRs look good. All white colonies selected contain a PCR product of appropriate size (i.e. larger than the blue colonies; negative [-C] control). Will select clones #1 from each to grow up for plasmid prep.

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

PCR – New Withering Syndrome Phage ISH Primers

Ran a PCR using the new ISH primers that I previously designed:

  • RLOv_tail_fiber_gene
  • RLOv_membrane_gene_1
  • RLOv_membrane_gene_2

Template DNA was black abalone DNA (from digestive gland [Dg]): 06:6-54 (from 4/9/2008)

Negative control DNA: UW08:22-11A (from 3/5/2007)

No template controls (NTCs) were also run.

All samples were run in duplicate, in 0.5mL PCR tubes.

 

Master mix calcs

REAGENT SINGLE REACTION (μL) x6.6 (μL)
Template 1 NA
2x Apex Red Master Mix 12.5 82.5
Primer Forward 0.5 3.3
Primer Reverse 0.5 3.3
H2O 11.5 75.9
TOTAL 25 Add 24μL to each tube

 

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

 

Samples were held O/N at 4C. Will run on gel tomorrow.

PCR – Ireland Clam RLO DNA S/6/14 #19

This is an exact repeat of the PCR from yesterday, but with a brand new vial of Apex Red Master Mix, in an attempt to eliminate the contamination previously seen in the NTCs.

Results:

Ladder: Hyperladder I (Bioline)

Well, for some reason there are still bands in the NTCs. However, they appear to be of different sizes than the bands in the clam DNA samples. I think they’re OK to use and the cloning/sequencing is cheap enough these days, that I’ll just get these sequenced and see what we have.

I excised each of the bands in the clam DNA samples (16s = ~2000bp; EUB = ~2100bp) and purified them using Ultrafree-DA spin columns (Millipore) in preparation for cloning.

PCR – Ireland Clam RLO DNA S/6/14 #19 from 20150130

After the last PCR continued to exhibit products in the no template controls (NTC) for most of the primer sets I was using, I ordered new primers. They arrived today so, I re-ran the PCR on the clam RLO DNA isolated 20150130 with the following new primers:

Master mix calcs are here: 20150223 – cPCR Universal Primers Apex Red MM

Cycling params were:
1 cycle of:

  • 95C – 10mins

40 cycles of:

  • 95C – 15s
  • 50C – 15s
  • 72C – 1min

Samples were run on 1.0% agarose, low TAE gel stained w/EtBr.

Results:

Ladder: Hyperladder I (Bioline).

Crazy; contamination still present in the NTCs. Primer stocks were steriley reconstituted with Low TE Buffer (IDT) and working stocks were created steriley, so I’m not really sure why this is continuing to happen. Possibly the polymerase is contaminated?  Will try again with previously unopened polymerase and see how that plays out.

No bands were excised since I can’t be certain that the bands present in the Clam DNA samples are from the actual sample and not from the apparent contamination.

PCR – Ireland Clam RLO DNA S/6/14 #19 (from 20150130)

After previously confirming that the issue with previous PCRs was due to bad reagents, I re-ran the PCR on the clam RLO DNA isolated 20150130 using a set of universal 16s primers, as well as a universal 18s primer set to serve as a positive control that amplifiable DNA was present in the sample.

Master mix calcs are here: 20150219 – cPCR Universal Primers Apex Red MM

Primers being used are:

  • 16s/23s-F/R
  • 27F, 1492R
  • EHR16D, EHR16R (universal ehrlichia)
  • EUB-A/B
  • 18s EUK 581 F, 18s EUK 1134 R

Cycling params were:
1 cycle of:

  • 95C – 10mins

40 cycles of:

  • 95C – 15s
  • 50C – 15s
  • 72C – 1mins

Samples were run on 1.0% agarose, low TAE gel stained w/EtBr.

Results:

Ladder used was O’GenRuler 100bp DNA Ladder (Thermo-Fisher).

No sample was loaded directly next to ladder to facilitate excision, if necessary.

Each sample was accompanied by a no template control (NTC).

The ehrlichia universal primers (EHR) and the universal 18s (18s) primers are the only two primer sets that do not have contamination present in the NTCs.

Excised the EHR band and purified with Ultrafree-DA columns (Millipore). Purified DNA was stored @ -20C and will be used for cloning/sequencing next week.

Have already ordered additional primer sets of those above that are contaminated. Will re-run the PCR with those new, sterile primer sets when they arrive to obtain a larger product (the EHR amplicon is only ~350bp).

PCR – Universal Primers w/New Master Mix

Since the previous check of the various universal primers with abalone DNA (sample 09:8-20) failed to amplify, even with withering syndrome primers, I’m testing repeating that PCR using a newer/different PCR master mix.

Template DNA is: 09:20-08 (from tissue)

Background info for template DNA is here: Red/Pink/Pinto

Primers being used are:

  • 16s/23s-F/R
  • 27F, 1492R
  • EHR16D, EHR16R (universal ehrlichia)
  • EUB-A/B
  • 18s EUK 581 F, 18s EUK 1134 R
  • WSN1 (withering syndrome)

Master mix calcs are here: 20150212 – cPCR Universal Primers 09:8-20 Apex Red MM

All samples were run in duplicate.

Cycling params were:
1 cycle of:

  • 95C – 10mins

40 cycles of:

  • 95C – 15s
  • 50C – 15s
  • 72C – 2mins

Ran samples out on a 0.8% agarose,  1x TBE gel w/EtBr

Results:

Well, this is a good result.  It demonstrates that the previous reagents that I had been using are no good. The primers work.  However, it does appear that all of the universal primers (excluding the 18s and EHR) are contaminated.  All of these primer sets were stocks that were prepared by other people and none of them were marked as being sterile (which they should be).  Regardless, I’ll re-run the Ireland clam DNA with all the primer sets and see how it turns out.  In the meantime, I’ll also order new universal primer sets to replace the existing, non-sterile sets.