PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Colony PCRs – Clam RLO 16s, EHR, EUB

Colony PCRs were performed on each of the three transformations from yesterday (16s, EHR, and EUB primers) using the M13F/R vector primers. Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp50+x-gal plate and then used to inoculate the respective PCR reactions. Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

Master mix calcs are here: 20150227 – Colony PCR Clam RLO

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

Ladder: Hyperladder I (Bioline)

Upper Left: 16s colonies 1 – 7

Upper Right: EHR colonies 1 – 6

Lower Left: EUB colonies 1 – 7

Based on the PCRs used for cloning, all white colonies screened exhibit the expected product sizes. Additionally, each of the blue (negative) colonies, produced the expected band size that are indicative of an empty plasmid.

Will select a positive colony from each set for mini prep and Sanger sequencing.

PCR – Colony Screens from Withering Syndrome 16s Cloning from yesterday

Selected 10 white colonies for PCR and restreaking. Master mix calcs are here.

Results:

 

Ladder = Hyperladder I (Bioline)

All colonies produced a band of the expected size (~1500bp). Will select three colonies to grow up for plasmid isolation.

PCR – Colonies from RLP Cloning on 20120425

Ran a conventional PCR on the colonies that were screened on 20120425 using both the WSN1 primers (used for the RLP qPCR assay) and the AF133090 (16s_1_F, 16s_1501_R) primers (used for cloning) to try to determine why the qPCR from yesterday failed to amplify anything in the newly prepared curve. The “Big Reds” fecal DNA extraction was used as the positive control, since it was used for cloning. Master mix calcs are here. Cycling params are as follows:

95C – 10m

40 cycles of:

  • 95C – 10s
  • 55C – 10s
  • 72C – 1.75m

Results:

Gel Loading:

Hyperladder I (Bioline)

Top of gel is 16s primer set (left to right): Colonies 1-8, Big Reds, NTC

Bottom of gel is WSN1 primer set(left to right): Colonies 1-8, Big Reds, NTC

So, what we see is that the 16s primer set, designed to amplify the entire GenBank AF133090 sequence gives similar results to the initial colony screening and generates an extremely intense band of the expected size (~1500bp), but this time all colonies are positive, whereas before, some were negative when using the M13 vector primers. Additionally, the positive control (Big Reds fecal DNA extract) looks just like the colonies that were generated from cloning. This is interesting, but the most important aspect to note is that when screening the colonies using the WSN1 primer set, all of them appear to be negative, including the sample used as a positive control (Big Reds fecal DNA extract). However, there may be a indistinct band at the expected band size (~150bp) in the positive control sample.

Smearing in all lanes is likely due to bacterial chromosomal DNA, since the PCRs used raw bacteria as template. Additionally, it is possible that the use of raw bacteria inhibited the reactions using the WSN primer set.

Will run a PCR using the plasmid prep as template (which I probably should have done in the first place!).

PCR – Colony Screening

Eight white colonies were selected for PCR screening to verify that they indeed contain the AF133090 insert, using M13 vector primers. Master mix calcs are here. Using sterile toothpicks, colonies were picked, re-streaked and then used to “inoculate” the PCR reactions. Cycling params were as follows:

1 cycle of:

  • 95C – 10m

40 cycles of:

  • 95C – 15s
  • 55C – 15s
  • 72C – 2m

PCR reactions were run on 0.8% TBE agarose gel.

Results:

Gel Loading:

Lane 1 – Hyperladder II (Bioline)

Lane 2 – Colony 1

Lane 3 – Colony 2

Lane 4 – Colony 3

Lane 5 – Colony 4

Lane 6 – Colony 5

Lane 7 – Colony 6

Lane 8 – Colony 7

Lane 9 – Colony 8

Lane 10 – NTC

The prominent bands seen on the gel all run at the expected size (~1600bp). Will select one of these re-streaked colonies for mini prep on Monday.