PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

PCR – RLOv In-situ Hybridization (ISH) Probes

Ran probe-labeling PCRs to use in in-situ hybridization (ISH) using the PCR DIG Probe Sysnthesis Kit (Roche). Generated PCR probes for using the following BamHI-linearized plasmids:

  • pCR2.1/RLOv_membrane_gene_1
  • pCR2.1/RLOv_membrane_gene_1
  • pCR2.1/RLOv_tail_fiber

The Roche protocol recommends using only 10pg of plasmid DNA for probe labelling. As such, all three probes were diluted 1:10,000. A 1:1000 (999μL H2O + 1μL of plasmid) was made first. Then a 1:10 dilution was made (90μL H2O + 10μL from 1:1000 dilution of plasmid).

Additionally, I ran half reactions to conserve kit components. Roche recommends 50μL reactions; I ran 25μL and scaled all components appropriately.

All reactions were set up on ice and run in 0.2mL strip-cap PCR tubes.

Reaction calculations are here (Google Sheet): 20151109 – RLOv ISH Probe PCRs

Cycling params:

  1. 95C – 5mins
  2. 95C – 15s
  3. 55C – 15s
  4. 72C – 30s
  5. Go to Step 2, repeat 39 times.
  6. 72C – 10mins

After the PCR, 5μL of each reaction was run on a gel.

Results:

Hyperladder I (Bioline)

PCR DIG probe labelling products run on 1.1% agarose 1x TBE gel stained w/EtBr. A ‘+’ indicates DIG reaction, while a ‘-‘ indicates no DIG in reaction.

Two reactions were run for each plasmid: one with the DIG label (indicated by a ‘+’) and one without (indicated by a ‘-‘). If the labeling was successful, the PCR products from those reactions containing DIG will be larger (i.e. migrate slower) than those without. That is exactly what we see in each of the three potential ISH targets.

So, we now have three ISH probes ready for action! Will proceed with making fresh ISH buffers and ISH.

Probes were transferred to 0.5mL snap cap tubes and stored in my -20C box.

Restriction Digestions – pCR2.1/RLOv Plasmids

Set up restriction digestions to linearize the pCR2.1/RLOv plasmids in preparation for ISH probes and qPCR standard curves. Used BamHI (NEB), since it doesn’t cut in any of the RLOv sequences and cuts one time in pCR2.1-TOPO (Invitrogen).

PLASMID Vol for 1.5μg (μL) H2O to 40μL
pCR2.1/RLOv_DNA_helicase 21.4 18.6
pCR2.1/RLOv_head_to_tail 11.1 28.9
pCR2.1/RLOv_membrane_gene_1 12.2 27.8
pCR2.1/RLOv_membrane_gene_2 14.3 25.7
pCR2.1/RLOv_tail_fiber 20 20

 

Digestion Master Mix

REAGENT SINGLE REACTION (μL) x 5.5 (μL)
Plasmid 40 NA
10x Buffer 3.1 (NEB) 5 27.5
BamHI (NEB) 1 5.5
H2O 4 22
TOTAL 50 Add 10μL to each tube

Digests were incubated at 37C for 1hr in PTC-200 thermal cycler (MJ Research); no heated lid.

Ran 3μL of undigested plasmid and 10μL of linearized plasmid on 0.8% agarose 1x TBE gel stained w/EtBR.

Results:

Hyperladder I (Bioline)

U = Undigested; Bam = BamHI digest

Besides the funky way this gel ran, the digests look to be complete.

Will quantify remaining linearized plasmids with a dye-based method for accurate quantification and then proceed with the making ISH probes (membrane genes and tail fiber gene) or qPCR standard curves (DNA helicase and head-to-tail).

 

PCR – RLOv Clones

Colony PCRs were performed on each of the transformations from 20151015 (RLOv_ DNA_helicase, RLOv_head_to_tail, RLOv_membrane_gene_1, RLOv_membrane_gene_2, RLOv_tail_to_fiber) to confirm successful ligations in plasmid pCR2.1 using the M13F/R vector primers.

Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp100+x-gal plate and then used to inoculate the respective PCR reactions.

Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Master mix calcs are here (Google Sheet): 20151019 – Colony PCRs RLOv

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

 

All the PCRs look good. All white colonies selected contain a PCR product of appropriate size (i.e. larger than the blue colonies; negative [-C] control). Will select clones #1 from each to grow up for plasmid prep.

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

Agarose Gel – Phage ISH Primers PCRs

Ran PCR products from yesterday on a 1% agarose 1x TBE gel, stained with ethidium bromide.

Results:

IMPORTANT NOTE: The negative control sample should actually be labelled UW08:22-11A.

 

PRIMER SET EXPECTED PCR SIZE (bp) RESULT SIZE (bp)
RLOv_membrane_gene_1 401 ~400bp
RLOv_membrane_gene_2 318 ~400bp
RLOv_tail_fiber_gene 451 ~500bp

PCR looks great. Excellent amplification in the RLO positive samples (06:6-54), with no amplification in the negative controls (UW08:22-11A) nor in the no template controls (NTC).

Excised the bands from each of the RLOv positive samples (see gel image below) and purified the DNA using UltrafreeDA Spin Columns (Millipore) according to the manufacturer’s protocol. DNA was stored @ 4C for cloning/labelling/sequencing at a later date.

Gel image showing excised regions.

Colony PCRs – Clam RLO 16s, EHR, EUB

Colony PCRs were performed on each of the three transformations from yesterday (16s, EHR, and EUB primers) using the M13F/R vector primers. Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp50+x-gal plate and then used to inoculate the respective PCR reactions. Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

Master mix calcs are here: 20150227 – Colony PCR Clam RLO

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

Ladder: Hyperladder I (Bioline)

Upper Left: 16s colonies 1 – 7

Upper Right: EHR colonies 1 – 6

Lower Left: EUB colonies 1 – 7

Based on the PCRs used for cloning, all white colonies screened exhibit the expected product sizes. Additionally, each of the blue (negative) colonies, produced the expected band size that are indicative of an empty plasmid.

Will select a positive colony from each set for mini prep and Sanger sequencing.