Sanger Sequencing – pCR2.1/OsHV-1 ORF117 Sequencing Data

Received the Sanger sequencing data back from Genewiz for the samples I submitted last week.

AB1 files were downloaded as a zip file and stored in the Friedman Lab server: backupordie/lab/sequencing_data/Sanger/30-19717124_ab1.zip

Files were analyzed using Geneious 10.2.3.

Geneious analysis was exported (compatible with version 6.0 and up) and saved to the Friedman Lab server:

backupordie/lab/sam/Sequencing_Analysis/Sanger/20170821_oshv_orf117_sanger.geneious

Results:

After vector ID and trimming, all sequences from both colonies were aligned, resulting in an 867bp contig. The size of this contig jives perfectly with the bright PCR band at ~1000bp I saw when screening the two colonies (the ~1000bp includes 300bp of vector sequence from using the M13 primers).

 

The alignment above shows that there were no gaps in the sequencing between the two sequencing primers (M13 forward and M13 reverse). I point this out because the insert in this plasmid was supposed to be the full-length OsHV-1 ORF117 (which is ~1300bp), as described in: Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015. As the sequencing shows, that is not what is cloned in this vector.

To determine what was actually cloned in this vector, I performed a BLASTx against the nr database, using the consensus sequence generated from the alignment above:

 

BLASTx generated a total of six matches, five of which match OsHV-1 ORF117 (the hypothetical and RING finger proteins listed above actually have alternate accession numbers that all point to ORF117). However, notice in the one alignment example provided at the bottom of the above image, the Query (i.e. our consensus sequence) only starts aligning at nucleotide 109 and matches up with the NCBI OsHV-1 ORF117 beginning at amino acid 158.

The results clearly show that the insert in this vector is OsHV-1 ORF117, but it is not the entire thing. To confirm this, I aligned the consensus sequence to the OsHV-1 genome (GenBank: AY509253.2) using Geneious:

 

In the image above, I have zoomed into the region in which our sequencing consensus aligned within the OsHV-1 genome. In order to see in more detail, please click on the image above. There are two noticeable things in this alignment:

  1. The insert we sequenced doesn’t span the entire ORF117 coding sequence (the yellow annotation in the image above).

  2. There’s a significant amount of sequence mismatch (112bp; indicated by black hash marks) between the sequenced insert and the OsHV-1 ORF117 genomic sequence from GenBank, at the 5′ end of the insert.

Will pass this info along to Carolyn and Tim to see how they want to proceed.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Performed PCR with M13 vector primers on the two colonies that grew from yesterday’s transformation.

Master mix calcs:

2x Apex Red Master PCR Mix: 33uL
M13 forward: 1.5uL
M13 reverse: 1.5uL
H2O: 29.7uL

Added 20uL to each PCR tube (0.2mL PCR strip tubes).

Bacteria was collected from each colony with a sterile 10uL pipet tip, which was used to streak on a separate LB Amp100 plate and then introduce bacteria to the appropriate PCR tube.

Cycling params (PTC-200 MJ Research):

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

Well, this might seem promising, due to the intensity of that band (~1000bp). A band of that size was also produced the last time, ableit with much less intensity.

The very bright, 1000bp band generated from Colonies 1 (left) and 2 (right) is not the expected size. Based on this paper (Detection of undescribed ostreid herpesvirus 1 (OsHV-1) specimens from Pacific oyster, Crassostrea gigas. Martenot et al. 2015), the insert size should be ~1300bp (Tim Green indicated he used the primers listed in the paper to clone ORF117).

However, there is a less bright band just above 1500bp. Oddly, this would be the expected size for this PCR (1300bp insert + 200bp of vector sequence from the M13 primers). The lower intensity is discouraging, though, because this indicates that M13 primers are preferentially binding whatever is producing that 1000bp band.

Regardless, I’ve already inoculated two liquid cultures to grow up over night. I’ll perform a plasmid isolation on them tomorrow morning. Hopefully they actually yield some plasmid DNA to do some work with, unlike last time.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

After the puzzling results from the last colony screening, I was able to get more info from Tim Green regarding the insert.

The insert was generated via PCR using OsHV-1 ORF 117 primers from this paper:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

This should generate a PCR product of ~1300bp. Knowing that, it’s no wonder my previous colony screen didn’t work; I didn’t set the extension time long enough! I increased the extension time to 90s to allow ample time for generating a 1300bp amplicon.

I re-screened the six re-streaked colonies using both the M13 plasmid primers and the ORF117 primers.

Master mix calcs:

2x Apex Red Master PCR Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

A miniscule amount of bacteria was collected from each streak with a sterile 10uL pipet tip, which was used to introduce bacteria to the appropriate PCR tube.

Cycling params:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

 

 

 

Well, these results are no less confusing than the previous colony screen!

M13 primers:

The strong, fuzzy “band” at ~100bp (the lowest band) is likely primer dimers, based on size/intensity. I could potentially redo this and raise the annealing temperature in hopes of eliminating this.

There is a band at ~600bp which I can’t explain.

Finally, a band is also seen at ~1000bp. This is close to the size of the actual coding sequence (CDS) for this OsHV open reading frame (ORF). The ORF contains some extraneous sequence on both ends of the CDS, leading to the ~1300bp length.

ORF117 primers:

There is a faint, yet defined, band at ~4000bp. Coincidentally, this is very close to the size of the empty plasmid (pCR2.1 is 3.9kb). It could be possible that the band that’s present is actually just the plasmid (although, it hasn’t/shouldn’t be linearized) and not an actual PCR product.

Overall, both results are confusing. I’ll just go ahead and sequence one of the colonies using the M13 primers and see what’s there.

PCR – pCR2.1/OsHV-1_ORF117 Colony Screens

Screened five colonies from yesterday’s transformation via PCR using M13 primers.

I don’t have any sequence for the actual insert, so am relying on assessing empty vector vs vector with insert, based on PCR amplicon size.

Master mix calcs:

2x GoTaq Green Master Mix: 80uL
M13 forward: 4uL
M13 reverse: 4uL
H2O: 88uL

Added 20uL to each PCR tube.

Colonies were selected randomly, streaked on a new LB Amp100 plate with a sterile pipet tip, and then added to the PCR tube.

Cycling params:

1 cycle

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 30s

1 cycle

72C – 5mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:


 

 

 

 

 

 

 

Well, these results are confusing. Immediate conclusion is that all colonies screened are empty, due to the small size of the amplicons produced (<100bp). However, looking at a vector map of pCR2.1 (the vector that the OsHV-1 ORF117 is supposedly cloned in), there are ~200bp between the M13 forward and M13 reverse primers. So, even an empty vector should produce an amplicon larger than what is seen on this gel.

I’ll contact Tim Green to see if he can provide any insight (and/or any actual sequence for OsHV-1 ORF117 so that I can order an insert specific primer to aid in confirmation).

Sanger Sequencing Submission – pCR2.1/RLOv Clones

Submitted the pCR2.1/RLOv clones from earlier this week for Sanger sequencing to Genewiz (order #10-313205054).

Submitted ~500ng of each plasmid in a final volume of 15μL (including primer). Each clone will be sequenced from each direction with M13F (-21) (25pmol; 2.5μL of 10μM stock) and M13R primers (25pmol; 2.5μL of 10μM stock) for a total of 10 sequencing reactions:

  • SW01    RLOv_DNA_Helicase-M13F_-21_
  • SW02    RLOv_head_to_tail-M13F_-21_
  • SW03    RLOv_membrane_gene_1-M13F_-21_
  • SW04    RLOv_membrane_gene_2-M13F_-21_
  • SW05    RLOv_tail_fiber-M13F_-21_
  • SW06    RLOv_DNA_Helicase-M13R
  • SW07    RLOv_head_to_tail-M13R
  • SW08    RLOv_membrane_gene_1-M13R
  • SW09    RLOv_membrane_gene_2-M13R
  • SW10    RLOv_tail_fiber-M13R

Sanger Sequencing Data – pCR2.1/Clam RLO clones

Received data from yesterday’s sequencing submission for GENEWIZ order: 10-291940235.  Clones from each of the three groups (16s, EHR, EUB) were sequenced (see below).

Raw sequencing data (.ab1) files were stored on: backupordie/Sequencing Data/Sanger/10-291940235_ab1.zip

  1. SW01 16s_C2_01-M13F(-21)
  2. SW02 16s_C2_02-M13R
  3. SW03 16s_C3_01-M13F(-21)
  4. SW04 16s_C3_02-M13R
  5. SW05 EHR_C2_01-M13F(-21)
  6. SW06 EHR_C2_02-M13R
  7. SW07 EHR_C3_01-M13F(-21)
  8. SW08 EHR_C3_02-M13R
  9. SW09 EUB_C2_01-M13F(-21)
  10. SW10 EUB_C2_02-M13R
  11. SW11 EUB_C3_01-M13F(-21)
  12. SW12 EUB_C3_02-M13R

Sanger Sequencing Submission – pCR2.1/Clam RLO clones

After the previous round of sequencing analysis, decided to sequence a couple of additional clones from each of the three groups: 16s, EHR, EUB. Submitted ~500ng (3μL) of clones #2 & #3 (C2 & C3) from each group to GENEWIZ for Sanger sequencing (Order #: 10-291940235). Each clone was sequenced from each direction with M13F (-21) and M13R primers for a total of 12 sequencing reactions:

  1. SW01 16s_C2_01-M13F(-21)
  2. SW02 16s_C2_02-M13R
  3. SW03 16s_C3_01-M13F(-21)
  4. SW04 16s_C3_02-M13R
  5. SW05 EHR_C2_01-M13F(-21)
  6. SW06 EHR_C2_02-M13R
  7. SW07 EHR_C3_01-M13F(-21)
  8. SW08 EHR_C3_02-M13R
  9. SW09 EUB_C2_01-M13F(-21)
  10. SW10 EUB_C2_02-M13R
  11. SW11 EUB_C3_01-M13F(-21)
  12. SW12 EUB_C3_02-M13R

Plasmid Isolation – Clam RLO 16s, EHR, & EUB clones

Prepared 1x LB + 50μg/mL ampicillin. Aliquoted 5mL of LB-Amp50 liquid media to 18 15mL conical tubes. Used the restreaked plates created 20150207 and used sterile pipette tips to select each of the six positive colonies from each cloning reaction and inoculate 5mL of LB-Amp50 liquid media. Tubes were incubated O/N @ 37C on a rocker.

All cultures grew. Three milliliters from each culture were used to isolate plasmid DNA using the QIAprep Spin Mini Kit (Qiagen). Samples were eluted with 50μL Buffer EB.

Frozen bacterial stocks were made from each of the six clones, using 500μL of each bacterial culture + 500μL of sterile, 50% glycerol in 2mL screw cap tubes.

Bacterial stocks and plasmid preps were labelled in the following fashion:

  • pCR2.1/Clam RLO 16s C1 – C6
  • pCR2.1/Clam RLO EHR C1 – C6
  • pCR2.1/Clam RLO EUB C1 – C6

where “C#” indicates the clone number. The bacterial stocks were stored @ -80C in the following box “Clones Box 2″:

 

Plasmid preps were quantified on the Roberts Lab NanoDrop1000.

Results:

Spreadsheet: 20150305_ClamRLO_miniprep_ODs

After speaking with Carolyn, she decided she wanted to sequence one clone from each group. Submitted ~500ng of clone #1 (C1) from each group to GENEWIZ for Sanger sequencing (Order #: 10-290123409). Each clone was sequenced from each direction with M13F (-21) and M13R primers for a total of 6 sequencing reactions:

1       SW01    16s_01-M13F(-21)
2       SW02    16s_02-M13R
3       SW03    EHR_01-M13F(-21)
4       SW04    EHR_02-M13R
5       SW05    EUB_01-M13F(-21)
6       SW06    EUB_02-M13R

Colony PCRs – Clam RLO 16s, EHR, EUB

Colony PCRs were performed on each of the three transformations from yesterday (16s, EHR, and EUB primers) using the M13F/R vector primers. Colonies were picked form the transformation plates with pipette tips, re-streaked on a secondary, gridded, numbered LBAmp50+x-gal plate and then used to inoculate the respective PCR reactions. Six white colonies (positive clones) and a single blue colony (negative clone) were selected from each transformation.

Restreaked plates were incubated @ 37C O/N and then stored @ 4C (Parafilmed).

Master mix calcs are here: 20150227 – Colony PCR Clam RLO

30μL of each reaction was run on a 1% agarose 1x Low TAE gel, stained w/EtBr.

Results:

Ladder: Hyperladder I (Bioline)

Upper Left: 16s colonies 1 – 7

Upper Right: EHR colonies 1 – 6

Lower Left: EUB colonies 1 – 7

Based on the PCRs used for cloning, all white colonies screened exhibit the expected product sizes. Additionally, each of the blue (negative) colonies, produced the expected band size that are indicative of an empty plasmid.

Will select a positive colony from each set for mini prep and Sanger sequencing.

PCR – Colony Screening

Eight white colonies were selected for PCR screening to verify that they indeed contain the AF133090 insert, using M13 vector primers. Master mix calcs are here. Using sterile toothpicks, colonies were picked, re-streaked and then used to “inoculate” the PCR reactions. Cycling params were as follows:

1 cycle of:

  • 95C – 10m

40 cycles of:

  • 95C – 15s
  • 55C – 15s
  • 72C – 2m

PCR reactions were run on 0.8% TBE agarose gel.

Results:

Gel Loading:

Lane 1 – Hyperladder II (Bioline)

Lane 2 – Colony 1

Lane 3 – Colony 2

Lane 4 – Colony 3

Lane 5 – Colony 4

Lane 6 – Colony 5

Lane 7 – Colony 6

Lane 8 – Colony 7

Lane 9 – Colony 8

Lane 10 – NTC

The prominent bands seen on the gel all run at the expected size (~1600bp). Will select one of these re-streaked colonies for mini prep on Monday.