PCR – OsHV-1 ORF117 from Australian, California, & French Variants

Carolyn had expressed interest in sequencing these.

I ran conventional PCRs using the ORF117 primers found in:

Genome exploration of six variants of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1μVar specimens. Martenot et al. 2013

OsHV_ORF117_F: GATGCACATCAGACACTGGC
OsHV_ORF117_R: CACACACTTTTAAACCATAAAGATGAG

Template DNAs were:

Aus A (Australian)
M1 (French)
TB15-15-305 (Californian)

All three template DNA samples were received from Carolyn/Colleen on 20171221. Used 2uL of 1:100 dilutions from each stock.

Master mix (25uL reactions)

2x Apex Red Master PCR Mix: 27.5uL
M13 forward: 1.1uL
M13 reverse: 1.1uL
H2O: 20.9uL

Cycling params were:

1 cycle:

95C – 10mins

30 cycles:

95C – 15s
55C – 15s
72C – 90s

1 cycle:

72C – 10mins

PCR reactions were run on a 1% agarose 1xTBE gel + EtBr.

5uL of O’GeneRuler DNA Ladder Mix was loaded for sizing.

Results:

The results are pretty interesting (but maybe not too helpful)!

Firstly, all three variants produced three different size products:

Aus A (Australian) – ~900bp
M1 (French) – ~1300bp
TB15-15-305 (Californian) – ~800bp

Of note, is that the paper from which these primers originated from, indicated that the PCR product generated was ~1300bp. The strain that that paper used for sequence analysis was the French strain (i.e. microVar)!

The other two strains amplified perfectly well, but are significantly smaller in size. This suggests a major deletion of some sort in ORF117 between the Australian/Californian vs. the French strain!

It also helps explain the discrepancy noted when we originally received the Australian ORF117 from Tim Green. He indicated his lab used the primers from the paper linked above and that the insert size was 1300bp. However, when I sequenced the ORF117 plasmid he sent to us, there was only 837bp of sequence (which would match the size of the product generated here, using the ORF117 primers from the paper)!

All bands were excised and DNA was purified using Ultrafree-DA spin columns (Millipore). I’ll clone all three and send of for sequencing.

PCR – RLOv for Cloning & Sequencing

After yesterday’s confirmation that the qPCR primer/probe sets for RLOv DNA helicase and head-to-tail were functional and specific for the RLOv, I needed to generate PCR products to clone and sequence.

Primers tested:

  • RLOv_DNA_helicase
  • RLOv_head_to_tail_gene

Template DNA:

  • 06:6-54

All samples were run in duplicate.

Master mix calcs are here: 20151009 – PCR RLOv

Cycling Params (PTC-200; MJ Research)

STEP TEMP (C) TIME (s)
Initial Denaturation
  • 95
  • 600
40 Cycles
  • 95
  • 55
  • 72
  • 15
  • 15
  • 30

Samples were run on a 0.8% agarose 1x TBE gel, stained with ethidium bromide.

Results:

Amplification looks great. No amplification in no template controls (NTCs). Excised bands and purified products using Ultrafree DA Spin Columns (Millipore). Samples will be stored @ 4C until I am able to clone them for sequencing.

 

Gel image showing excised bands. And, it’s a complete hack job, which is embarrassing…

Agarose Gel – Phage ISH Primers PCRs

Ran PCR products from yesterday on a 1% agarose 1x TBE gel, stained with ethidium bromide.

Results:

IMPORTANT NOTE: The negative control sample should actually be labelled UW08:22-11A.

 

PRIMER SET EXPECTED PCR SIZE (bp) RESULT SIZE (bp)
RLOv_membrane_gene_1 401 ~400bp
RLOv_membrane_gene_2 318 ~400bp
RLOv_tail_fiber_gene 451 ~500bp

PCR looks great. Excellent amplification in the RLO positive samples (06:6-54), with no amplification in the negative controls (UW08:22-11A) nor in the no template controls (NTC).

Excised the bands from each of the RLOv positive samples (see gel image below) and purified the DNA using UltrafreeDA Spin Columns (Millipore) according to the manufacturer’s protocol. DNA was stored @ 4C for cloning/labelling/sequencing at a later date.

Gel image showing excised regions.

PCR – Ireland Clam RLO DNA S/6/14 #19

This is an exact repeat of the PCR from yesterday, but with a brand new vial of Apex Red Master Mix, in an attempt to eliminate the contamination previously seen in the NTCs.

Results:

Ladder: Hyperladder I (Bioline)

Well, for some reason there are still bands in the NTCs. However, they appear to be of different sizes than the bands in the clam DNA samples. I think they’re OK to use and the cloning/sequencing is cheap enough these days, that I’ll just get these sequenced and see what we have.

I excised each of the bands in the clam DNA samples (16s = ~2000bp; EUB = ~2100bp) and purified them using Ultrafree-DA spin columns (Millipore) in preparation for cloning.

PCR – Ireland Clam RLO DNA S/6/14 #19 (from 20150130)

After previously confirming that the issue with previous PCRs was due to bad reagents, I re-ran the PCR on the clam RLO DNA isolated 20150130 using a set of universal 16s primers, as well as a universal 18s primer set to serve as a positive control that amplifiable DNA was present in the sample.

Master mix calcs are here: 20150219 – cPCR Universal Primers Apex Red MM

Primers being used are:

  • 16s/23s-F/R
  • 27F, 1492R
  • EHR16D, EHR16R (universal ehrlichia)
  • EUB-A/B
  • 18s EUK 581 F, 18s EUK 1134 R

Cycling params were:
1 cycle of:

  • 95C – 10mins

40 cycles of:

  • 95C – 15s
  • 50C – 15s
  • 72C – 1mins

Samples were run on 1.0% agarose, low TAE gel stained w/EtBr.

Results:

Ladder used was O’GenRuler 100bp DNA Ladder (Thermo-Fisher).

No sample was loaded directly next to ladder to facilitate excision, if necessary.

Each sample was accompanied by a no template control (NTC).

The ehrlichia universal primers (EHR) and the universal 18s (18s) primers are the only two primer sets that do not have contamination present in the NTCs.

Excised the EHR band and purified with Ultrafree-DA columns (Millipore). Purified DNA was stored @ -20C and will be used for cloning/sequencing next week.

Have already ordered additional primer sets of those above that are contaminated. Will re-run the PCR with those new, sterile primer sets when they arrive to obtain a larger product (the EHR amplicon is only ~350bp).

PCR – Withering Syndrome Phage

We received MiSeq data back from Stan Langevin (samples submitted 20140717) and he believes he has sequenced the entire WS phage. Carolyn and Colleen designed some primers on two of the open reading frames annotated by Stan. Ran PCR with the three primer sets to test out:

  • 1_ORF25F_225_CSF, 1_ORF25R_399_CSF
  • 2_ORF25_121_CAB, 2_ORF25R_320_CAB
  • 3_ORF20F_121_CSF, 3_ORF20R_326_CSF

Master mix calcs are here: 201400813 – PCR WS phage

Cycling params:

Ran samples on 1.2% 1x TBE + EtBr.

Results:

Ladder: O’GeneRuler 100bp DNA Ladder (ThermoFisher)

Good amplification from all three primer sets. The pinto abalone sample (UW08:22-65) that should be naive for withering syndrome and phage did not amplify as expected.

Excised bands from each primer set in the 06:6-41 group and purified using Ultrafree DA spin columns (Millipore). Will save for potential cloning usage, depending on future results.

Chloroform Cleanup – EcoRI-digested Withering Syndrome Phage DNA from earlier today

To concentrate the sample, a chloroform cleanup and EtOH precipitation was performed. An equal volume of chloroform was added to the sample (220uL), vortexed for 30s and spun @ 16,000g at 4C for 15mins. The aqueous phase was transferred to a clean tube for EtOH precipitation.

0.1 volumes (16.8uL) of 3M NaOAC (sodium acetate; pH = 5.2) and 2.5 volumes (462uL) of ice cold 100% EtOH were added to the sample and mixed thoroughly. The sample was incubated O/N at -20C. The following day the sample was pelleted by spinning at 16,000g at 4C for 30mins. As expected, there was no visible pellet due to the extremely low quantity of DNA in the sample. The supernatant was discarded, the pellet was gently washed (no mixing/vortexing) with 70% EtOH, and spun @ 16,000g at 4C for 15mins. The supernatant was discarded the pellet was air dried for 15mins. The sample was reconstituted in 10uL of Buffer EB (Qiagen), which is simply 10mM Tris-HCl, and stored at 4C.

Gel Purification – EcoRI-digested pCR2.1 Vector from earlier today

Gel-excised band from earlier today was purified using the Ultra DA-free (Millipore) spin column according to the manufacturer’s protocol. Purified DNA was stored at 4C.

Restriction Digestions – Withering Syndrome Phage DNA and p16RK3

Performed restriction digestions on Phage RLO DNA (isolated on 20121130) and p16RK3 using EcoRI from NEB.

Phage RLO Digest

  • DNA – 192uL
  • 10x EcoRI Buffer – 22uL
  • EcoRI – 4uL
  • H2O – 2uL
  • TOTAL = 220uL

p16RK3 Digest

  • DNA (1ug) – 5.39uL
  • 10x EcoRI Buffer – 5uL
  • EcoRI – 1uL
  • H2O – 38.61uL
  • TOTAL = 50uL

Samples were incubated at 37C for 1hr. The p16RK3 sample was run on a 0.8% TBE gel to confirm digestion and isolate the vector-only band from the sample. The Phage RLO sample was subject to a chloroform cleanup and EtOH precipitation.

Results:

Digestion of Phage RLO DNA was not verified due to the extremely low quantities of DNA. In order to minimize loss of material, we will trust that the digestion was successful if the digestion of p6RK3 was successful.

Gel Loading

Lane 1 – Hyperladder I (Bioline)

Lane 2 – p16RK3 EcoRI

Neglected to run undigested p16RK3. However, the digestion pattern looks correct. The empty vector (pCR2.1; Invitrogen) should be 3931bp and we see the largest molecular weight band of the digest is running at ~4000bp. That band was excised and will be purified for subsequent ligation.

PCR – Cloning AF133090 for New RLP Standard Curve

Ran PCR using newly ordered primers (WS_16s_1_F, WS_16s_1501_R) that should amplify the entirety of AF133090 in order to create a new RLP plasmid standard curve for the RLP qPCR assay. Master mix calcs are here. Template used was “Big Reds” fecal DNA extraction by Lisa on 4/3/2012. Sample was run on a 0.8% TBE gel.

Results:

Lane Loading Guide:

Lane 1 – Hyperladder I (Bioline)

Lane 2 – AF133090 PCR

Lane 3 – NTC

Success! The bright band in the Af133090 sample is at exactly 1500bp, as expected. This band was excised and purified using an Ultra-DA column (Millipore). The extensive smearing in this lane is most likely due to the template used, which consists of a DNA extract from abalone feces. This sample likely contains a high amount of DNA, which results in the high molecular weight smearing seen.